COVID19 – Evidence of global fraud
Sunday, December 13, 2020 by: News Editors
Tags: badhealth, badmedicine, Big Pharma, conspiracy, coronavirus, covid-19, fraud, global fraud, lies, lockdown, mask mandate, outbreak, pandemic, science fraud, vaccines
DistributedNews
(Natural News) COVID 19, and the subsequent governmental responses, appear to be part of an international conspiracy to commit fraud. It seems there is no evidence that a virus called SARS-CoV-2 causes a disease called COVID 19.
(Article by Iain Davis republished Off-Guardian.org)
Sometimes you have to go with your gut. I am not an expert in genetics and, as ever, stand to be corrected. However my attention was drawn to some research published by the Spanish medical journal D-Salud-Discovery. Their advisory board of eminently qualified physicians and scientists lends further credibility to their research. Their claim is astounding.
The genetic primers and probes used in RT-PCR tests to identify SARS-CoV-2 do not target anything specific. I followed the search techniques outlined in this English translation of their report and can corroborate the accuracy of their claims about the nucleotide sequences listed in the World Health Organisations protocols. You can do the same.
D-Salud-Discovery state there are no tests capable of identifying SARS-CoV-2. Consequently, all claims about the alleged impact of COVID 19 on population health are groundless.
The entire official COVID 19 narrative is a deception. Ostensibly, there is no scientific foundation for any part of it.
If these claims are accurate we can state that there is no evidence of a pandemic, merely the illusion of one. We have suffered incalculable loss for no evident reason, other than the ambitions of unscrupulous despots who wish to transform the global economy and our society to suit their purposes.
In doing so this “parasite class” have potentially committed countless crimes. These crimes can and should be investigated and prosecuted in a court of law.
IDENTIFICATION OF WHAT EXACTLY?
The World Health Organisation (WHO) classified COVID-19 (COronaVIrus Disease 2019). They declared a global COVID 19 pandemic on March 11th 2019.
The WHO’s Laboratory testing guidance states:
The etiologic agent [causation for the disease] responsible for the cluster of pneumonia cases in Wuhan has been identified as a novel betacoronavirus, (in the same family as SARS-CoV and MERS-CoV) via next generation sequencing (NGS) from cultured virus or directly from samples received from several pneumonia patients.”
The WHO’s claim is that the SARS-CoV-2 virus causes the disease COVID-19. They also allege this virus has been clearly identified by researchers in Wuhan.
In the WHO’s Novel Coronavirus 2019-nCov Situation Report 1, they state:
The Chinese authorities identified a new type of coronavirus, which was isolated on 7 January 2020……On 12 January 2020, China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”
These two statements from the WHO clearly suggest the SARS-CoV-2 virus was isolated (meaning purified for study) and then genetic sequences were identified from the isolated sample. From this, diagnostic kits were developed and distributed globally to test for the virus in towns, cities and communities around the world. According to the WHO and Chinese researchers, these tests will find the virus that causes COVID 19.
Yet the WHO also state:
Working directly from sequence information, the team developed a series of genetic amplification (PCR) assays used by laboratories.”
The Wuhan scientists developed their genetic amplification assays from “sequence information” because there was no isolated, purified sample of the so called SARS-CoV-2 virus. They also showed electron microscope images of the newly discovered virions (the spiky protein ball containing the viral RNA.)
However, such protein structures are not unique. They look just like other round vesicles, such as endocytic vesicles and exosomes.
Virologists claim that it is not possible to “isolate” a virus because they only replicate inside host cells. They add that Koch’s postulates do not apply because they relate to bacteria (which are living organisms). Instead, virologists observe the virus’ cytopathogenic effects (CPE), causing cell mutation and degradation, in cell cultures.
When Chinese researchers first sequenced the full SARS-CoV-2 genome they observed CPE in Vero E6 and Huh7 cells. Vero E6 are an immortalised monkey cell line and Huh7 are immortalised cancer (tumorigenic) cells. Meaning they have been maintained in vitro (in petri dish cultures) for many years.
Central to the official SARS-CoV-2 story is the idea that it is a zoonotic virus, capable of bridging the species gap from animals to humans. When scientists from the US CDC “infected” various cells with the novel virus they noted the following:
We examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549) [lung celles], human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81 [monkey cells]…No cytopathic effect was observed in any of the cell lines except in Vero cells [monkey cells]…HUH7.0 and 293T cells showed only modest viral replication and A549 cells [human lung tissue cells] were incompatible with SARS-CoV-2 infection.”
The CDC did not observe any CPE in human cells. They saw no evidence that this alleged virus caused any human illness. Nor did this supposed human virus show any notable replication in human cells, suggesting human to human infection would be impossible.
Noting this problem, a team of Polish scientists introduced this sequenced “virus” to human epithethelium (airway) cells. They observed the effects on these HAE cultures for 5 days. They noted much greater replication than the CDC scientists but ultimately stated:
“We did not observe any release of the virus from the basolateral side of the HAE culture.”
Meaning they did not see any evidence of the supposed virions breaching the cell wall membrane. Again suggesting this so called virus isn’t infectious in human beings.
It is not clear that SARS-CoV-2 is a human virus capable of causing illness. It may not even physically exist. Is it nothing more than a concept based upon predictive genetic sequences?
VOYAGE OF DISCOVERY
The Wuhan Center for Disease Control and Prevention and the Shanghai Public Health Clinical Centre published the first full SARS-CoV-2 genome (MN908947.1 ). This has been updated many times. However, MN908947.1 was the first genetic sequence describing the alleged COVID 19 etiologic agent (SARS-CoV-2).
All subsequent claims, tests, treatments, statistics, vaccine development and resultant policies are based upon this sequence. If the tests for this novel virus don’t identify anything capable of causing illness in human beings, the whole COVID 19 narrative is nothing but a charade.
The WUHAN researchers stated that they had effectively pieced the SARS-CoV-2 genetic sequence together by matching fragments found in samples with other, previously discovered, genetic sequences. From the gathered material they found an 87.1% match with SARS coronavirus (SARS-Cov). They used de novo assembly and targeted PCR and found 29,891-base-pair which shared a 79.6% sequence match to SARS-CoV.
They had to use de novo assembly because they had no priori knowledge of the correct sequence or order of those fragments. Quite simply, the WHO’s statement that Chinese researchers isolated the virus on the 7th January is false.
The Wuhan team used 40 rounds of RT-qPCR amplification to match fragments of cDNA (complimentary DNA constructed from sampled RNA fragments) with the published SARS coronavirus genome (SARS-CoV). Unfortunately it isn’t clear how accurate the original SARS-CoV genome is either.
In 2003 a team of researchers from from Hong Kong studied 50 patients with severe acute respiratory syndrome (SARS). They took samples from 2 of these patients and developed a culture in fetal monkey liver cells.
They created 30 clones of the genetic material they found. Unable to find evidence of any other known virus, in just one of these cloned samples they found genetic sequences of “unknown origin.”
Examining these unknown RNA sequences they found 57% match to bovine coronavirus and murine hepatitis virus and deduced it was of the family Coronaviridae. Considering these sequences to suggest a newly discovered SARS-CoV virus (new discoveries being ambrosia for scientists), they designed RT-PCR primers to test for this novel virus. The researchers stated:
Primers for detecting the new virus were designed for RT-PCR detection of this human pneumonia-associated coronavirus genome in clinical samples. Of the 44 nasopharyngeal samples available from the 50 SARS patients, 22 had evidence of human pneumonia-associated coronavirus RNA.”
Half of the tested patients, who all had the same symptoms, tested positive for this new alleged virus. No one knows why the other half tested negative for this novel SARS-CoV virus. The question wasn’t asked.
This supposed virus had just a 57% sequence match to allegedly known coronavirus. The other 43% was just “there.” Sequenced data was produced and recorded as a new genome as GenBank Accession No. AY274119.
The Wuhan researchers subsequently found an 79.6% sequence match to AY274119 and therefore called it a novel strain of SARS-CoV (2019-nCoV – eventually renamed SARS-CoV-2). No one, at any stage of this process, had produced any isolated, purified sample of any virus. All they had were percentage sequence matches to other percentage sequence matches.
ISOLATE NOTHING
Scientists are very annoyed because they keep saying the virus has been isolated but no one believes them. This is because, as yet, no one has provided a single purified sample of the SARS-CoV-2 virus. What we have instead is a completed genome and, as we are about to discover, it isn’t particularly convincing.
Investigative journalists Torsten Engelbrecht and Konstantin Demeter asked some of the scientists who said they had images of SARS-C0V-2 virions to confirm these were images of an isolated, purified, virus. None of them could.
In Australia scientists from the Doherty Institute, announced that they had isolated the SARS-CoV-2 virus. When asked to clarify the scientists said:
“We have short (RNA) sequences from the diagnostic test that can be used in the diagnostic tests”
This explains why the Australian government state:
The reliability of COVID-19 tests is uncertain due to the limited evidence base…There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”
In The UK, in July, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in which they asked him to:
Produce independently peer reviewed scientific evidence proving that the Covid-19 virus has been isolated.”
To date they have not received a reply.
Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England (PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus. To which they responded:
PHE can confirm it does not hold information in the way suggested by your request.”
Canadian researcher Christine Massey made a similar freedom of information request, asking the Canadian government the same. To which the Canadian government replied:
Having completed a thorough search, we regret to inform you that we were unable to locate any records responsive to your request.”
In the U.S. the Centre For Disease Control (CDC) RT-PCR Diagnostic Panel state:
…No quantified virus isolates of the 2019-nCoV are currently available……..Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.”
Last updated on 13th July 2020, the CDC are yet to obtain any pure viral sample from any patient said to have the disease of COVID-19. They openly admit their tests don’t necessarily show if SARS-CoV-2 is either present or causes COVID 19.
We are told that none of this matters. That we are ignorant and just don’t understand virology. Therefore, we must accept pictures of things we know could be something else and genetic sequences (which could be anything else) as conclusive proof that this virus, and the disease it is supposed to cause, are real.
TESTING FOR NOTHING
The WHO, and every government, think tank, policy steering committee, government scientific advisor, supranational institutions and others who promote the official COVID 19 narrative, assert that SARS-CoV-2 causes COVID 19.
While no one has ever produced a sample of this supposed virus, the alleged SARS-CoV-2 genome has been published. It is in the public domain.
Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to identify the presence of the “virus”. These include:
RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of COVID 19 diseased epithelial cells.
S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.
E gene (Orf1ab) – small membrane protein used in viral assembly
N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation
The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)
The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers.
It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in a sample.
Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore we can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences.
The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.
The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.
However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.
Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.
Whenever we check the so-called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.
So called fact checkers, like Reuters’ Health Feedback project, have been quick to dismiss the claims of those who have noticed the apparent lack of specificity in the supposed SARS-CoV-2 genome.
Using a slew of strawman arguments like, “this claim suggests every test should be positive,” (which it doesn’t) their debunking attempt runs something like this:
Primers are designed to bind to specific nucleotide sequences that are unique to the virus. The forward primer may bind to a particular chromosome but the reverse primer doesn’t bind to the same chromosome and so the chromosome is not present in the SARS-CoV-2 virus. Moreover because the forward and perverse primers envelop the sequence to be amplified the cDMA sequence between primers is unique to the virus.
This seems to deliberately misrepresent the significance of these findings by forwarding an argument that no one, other than the fact checkers themselves, are making. BLAST searches show that these target sequences are not unique to SARS-CoV-2. Nor do all targets need to be found for a result to be deemed positive.
Moroccan researchers investigated the epidemiology of Moroccan alleged cases of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As we have just discussed, many may have been positive for none.
This is entirely in keeping with WHO’s test guidelines. They state:
“An optimal diagnosis consists of a NAAT [nucleic acid amplification test] with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used……One or more negative results do not necessarily rule out the SARS-CoV-2 infection.”
Regardless of the spurious arguments of well funded fact checkers, if the forward and reverse primers identify junk, perhaps one being the fragment of a chromosome and the other a microbial sequence, then the amplified region between them is probably junk too.
The argument that RT-PCR only finds RNA is specious. Natural transcription (the separation of DNA strands) occurs during gene expression. No one is saying whole chromosomes or microbes are sequenced in the alleged SARS-CoV-2 genome. Though they may, for all we know. They are saying the alleged markers, used to test for this supposed virus, are not fit for purpose.
RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called “junk,” DNA (cDNA.)
For example the SARS-CoV-2 S gene is meant to be highly specific to the SARS-CoV-2 virus genome. The target sequence is – TTGGCAAAATTCAAGACTCACTTTC. A microbial BLAST search returns 97 microbial matches with 100% identity sequence match. The lowest identity percentage match, within the top 100, is 95%. A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments.
No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO’s test protocols that clearly identifies what it is. The whole genome could be false. The tests do not prove the existence of SARS-CoV-2. All they reveal is a soup of unspecified genetic material.
If so, as there are no isolates or purified samples of the virus, without a viable test, there is no evidence that SARS-CoV-2 exists. Therefore, nor is there any evidence that a disease called COVID 19 exists.
This infers that there is no scientific basis for any claims about COVID 19 case numbers, hospital admissions or mortality figures. All measures taken to combat this deadly virus are quite possibly founded upon nothing.
CONCLUSIVE FRAUD
Fraud is a criminal act. The legal definition of fraud is:
“Some deceitful practice or willful device, resorted to with intent to deprive another of his right, or in some manner to do him an injury.”
The Legal definition of a conspiracy is:
“A combination or confederacy between two or more persons formed for the purpose of committing, by their joint efforts, some unlawful or criminal act”
It seems, those who claim we face a pandemic have not provided any evidence to show that a virus called SARS-CoV-2 causes a disease called COVID 19. All of the information strongly suggesting this possibility is readily available in the public domain. Anyone can read it.
For there to be a fraud the deceit must be wilful. The intention must be to deliberately deprive others of their rights or injure them in some other way. If there is evidence of collusion between individuals ad/or organisations to commit fraud, then this is a conspiracy (in Common Law jurisdictions) or a Joint Criminal Enterprise (JCE) under International Law.
It seems COVID 19 has been deliberately used as a casus belli to wage war on humanity. We have been imprisoned in our own homes, our freedom to roam restricted, freedom of speech and expression eroded, rights to protest curtailed, separated from loved ones, our businesses destroyed, psychologically bombarded, muzzled and terrorised.
Worse still, while there is no evidence of unprecedented all cause mortality, there were unseasonable spikes in deaths. These correlate precisely with Lockdown measures which saw the withdrawal of the health services we pay for and a reorientation of public health services to treat one alleged disease at the exclusion of all others.
Further, it is proposed by those who have forwarded the COVID 19 story, that this alleged disease provides justification for the complete restructuring of the global economy, our political systems, societies, cultures and humanity itself.
To be allowed to participate in their so called “new normal,” which is the wholesale transformation of our entire society without our consent, they insist we submit to their conditions.
These include, but aren’t limited to, bio-metric surveillance of everyone, the centralised control and monitoring of all of our transactions, oppressive business and social restrictions and an effective demand that we have no right to sovereignty over our own bodies. This constitutes the condition of slavery.
There is no doubt that we have been deprived of our rights and injured. In Common Law jurisdictions innocence is presumed, but the evidence that harm has been deliberately caused by an international conspiracy is overwhelming. Destructive policies, enacted by governments across the world, clearly originated among globalist think tanks and supranational institutions long before the emergence of this non existent pandemic.
In Napoleonic Code jurisdictions, guilt is presumed. In order for the accused conspirators to prove their innocence they must show that, despite their immeasurable resources, they have collectively been unable to access or understand any of the freely available evidence suggesting COVID 19 is a myth.
Those responsible for the crime of conspiracy to commit global fraud should be tried. If found guilty they should be imprisoned while the rest of us get on with trying to repair the damage they have already inflicted.
xxxxxxxxxxxxxxxxxxxxxxxxxxxx
by Fabio Giuseppe Carlo Carisio
In response to the some requests from friends and readers who highlighted the excessive length of the Gospa News reports on the hidden background of the pandemic – exhaustive and reliable investigations precisely because they are based on a wealth of carefully verified details – we have created the summary of the 9 dossiers so far published on CoVid-19 (or SARS-2) before devoting ourselves to the following; which will be shorter because they will refer to this recap.
WUHAN-GATE – 1. GOLDEN INTRIGUES BIOWEAPON-VACCINES among China, Us-CIA, Saudi and Big Pharma J&J – GSK
In 100 lines here are clues and authoritative accusations in support of the pandemic theory triggered by an alleged bacteriological weapon that lead up to the New World Order’s prophecy made by a former deputy director of the Central Intelligence Agency (CIA).
It is at least ascertained that the American counter-intelligence has funded, together with the Pentagon agencies (USAID, DTRA, DARPA), various secret projects in military biological laboratories in China, Georgia, Ukraine and in the USA too. These also include those on 89 CoronaVirus strains (report 9).
1 – THE US EXPERT: “CORONAVIRUS IS A BIO-WEAPON
The first to speak of a bacteriological is the American expert on biological threats Francis Boyle confirming the suspicions of many. He point at the researches in the Bls-4 laboratory in Wuhan, where the epidemic broke out and the hero doctor who discovered it (Li Weinliang) died. Instead he doesn’t mention the 25 military centers for testing epidemic viruses open all over the world by the Pentagon DTRA (Defense Threat Reduction Agency (US Defense Department) as noted in 2018 by Bulgarian journalist Dilyana Gaytandzhieva.
In her investigation, the reporter also describes tests on bio-genetic weapons capable of affecting a specific ethnic group and considered “potentially unstoppable” by a study published in August 2019 by the Center for the Study of Existential Risk (CSER) of the University of Cambridge. A suspicious CoronaVirus research was also launched in 2015 by the British Pirbright Institute funded by the Bill Gates foundation.
CoronaVirus – 1. “IT’S BIO-WEAPON”. Us Expert blames China but forgets 25 Pentagon’s Secret Labs for “Ethnic Attacks”
2 – INTEL DROP: “A BIO-WEAPON DIFFUSED WITH NANO-DRONES”
The theory of a bacteriological attack is also supported by Jeff Brown, founder with other international journalists and authors of the Bioweapon Truth Commission. Chinese scientists discover that the virus’s protein S has been shaped to hide the mutation of certain amino acids which makes it aggressive. The Communist Party of China accuses the US. Our foreign intelligence source point the finger at the Central Intelligence Agency, the richest and most powerful American counter-intelligence in the world.
It could have been the CIA to spread the CoronaVirus in China and other countries with the use of nano-drones, but whoever had spread it would already have the vaccine. It turns out that the first cyber-insect project to be used as a reconnaissance mini-UAV (or transport of very small payloads) was developed by the US 007 in 1970.
CoronaVirus BioWeapon – 2. Intel sources: «Spread by CIA with nano-Uav» as Cyber-DragonflEye. Alert in Iran and Italy
There is now the 10cm Black Hornet 3 mini-helicopter, used by NATO armies, and DragonflEye, a genetically modified dragonfly driven by light. Vaccine research is initiated in Australia by the University of Queensland with support from the UK’s Big Pharma GlaxoSmithKline: these are two countries of the famous “FIVE Eyes” in the USUKA agreement created by the USA with the other English-speaking intelligence of Canada and New Zealand.
3 – DOUBLE VIRUS COVID. GOLDEN VACCINE OF GSK FINANCED BY GATES
The giant GlaxoSmithKLine, finished over the years in the midst of various scandals with judicial investigations in Italy as in the United States, is among the first to make commercial agreements for the vaccine with China as soon as the University of Queensland confirms that it has found a prototype to be tested.
An American and an Israeli company also claim to have already found the antidote, arousing the suspicions of Chinese experts who, meanwhile, have discovered another secret of the CoVid-19 virus: there are at least two genotypes, one of high morbidity but lower mortality, the other more aggressive and more lethal generated by an unidentified human interaction.
LOBBY ARMI – 1: BLACKROCK E GLI ALTRI AFFARISTI DELLE GUERRE USA
The vaccine will become golden given the seriousness of the epidemic. In addition to being a British corportation, GSK is participated in by the largest American investment funds in the Weapons Lobby. Glaxo CEO is also director of Microsoft owned by Bill Gates who, through the international body CEPI (presented in Davos in 2017) finances the vaccine research.
But GSK is also a partner of the Pentagon and its DARPA agency which also operates on biological research in the military. Iran’s Islamic Revolutionary Guards and a former CIA agent support the bio-weapon theory that is almost completely ignored by Italian newspapers.
CoronaVirus BioWeapon – 3. GSK Golden Vaccine’s Ring with Bill Gates, Pentagon and Zionist’s BlackRock
4 – PANDEMIC ARRIVES AS FORESEEN BY GATES
On 11 March 2020, the World Health Organization declares the Pandemic. As expected by the American billionaire Bill Gates in a 2015 TED conference and then by a somewhat suspicious exercise organized in October 2019, a few weeks before the first outbreak of December in China, just for a CoronaVirus emergency.
At the speakers’ table there is also a former CIA executive, among the main suspects for the pandemic. Among the countries most affected by CoVid-19 are Iran, Washington and Tel Aviv enemy, and Italy which, in January 2020, had restarted the dialogues for a bilateral agreement on Artificial Intelligence.
CoronaVirus BioWeapon – 4. PANDEMIC! As Predicted in Bill Gates forum (video) with ex-CIA. Italy and Iran Massacred in Bio-Warfare for their A.I. Deal
5 – FROM IRAN AND SRI LANKA ACCUSATIONS ON BIO-WEAPON
Former Iranian President Mahmoud Ahmadinejad wrote a vibrant letter to the UN to urge an international investigation into the bacteriological weapon he believes caused the pandemic. The same request is made at a press conference by the Sri Lankan cardinal Malcom Ranjith, Archbishop of Colombo (affected by the massacres of the ISIS suicide bombers in Easter 2019).
The letter from the former Iranian head of state, unpopular with the Tehran government itself, is ignored by almost all the media in the world. The appeal of the high prelate of the Catholic Church, issued by an Asian agency of Christian inspiration, is published with minimal emphasis only on a few western media.
CoronaVirus BioWeapon – 5. Cardinal Blames: “A Rich Country Sowed This Poison. UN must Investigate”
6 – THE PROPHECY OF THE FORMER DEPUTY DIRECTOR CIA
Avril Haines, thanks to her loyalty to the US Democratic Party, has made a lightning career in the shadow of former President Barack Obama and his deputy Joe Biden (today in the running for the 2020 presidential elections): from graduation to CIA in just 12 years!
She was appointed first deputy director of the Central Intelligence Agency and then deputy White House National Security Consultant, also becoming a biological weapons consultant for the NTI, a Democratic area organization for the study of nuclear and bacteriological threats against the United States.
During a 2018 conference, Haines predicts the risk of a respiratory infection pandemic, just as did in 2015 the same Gates, which finances the Event 201 exercise of October 2019 in which the former intelligence officer was among the protagonists. Deep State’s shadow lurks behind the alleged bacteriological weapon epidemic…
CoronaVirus BioWeapon – 6. Prophecy on Pandemic and NWO by Obama-Biden CIA’s Queen
7 – US BIO-LABS IN THE COUNTRIES OF COLORED REVOLUTIONS
Various Western media focuses on suspicious military maneuvers that occurred in 2019. From the American delegation that took part in the Wuhan World Military Games in October to the mysterious suspension of research activity in Fort Detrick, home of the USAMIID (US Army laboratories Medical Institute of Infectious Diseases). At the end of 2019, the Naval Medical Resarch Unit, called NAMRU 3, suddenly moved from Egypt to NATO’s Sigonella NAS base in Sicily, one of the main CIA stations in Italy and the Mediterranean.
The curious coincidence emerges that numerous top secret bacteriological research laboratories of the Pentagon have been opened in the past years in Ukraine and Georgia after the coups of the colored revolutions financed by George Soros, supporter of Democrats in the US as in Europe.
CoronaVirus BioWeapon – 7. NWO-CIA-DEM Top Secret Military Missions in Ukraine, Fort Detrick, Sigonella, Wuhan, Modena
8 – RUSSIA HELPS ITALY AGAINST BIO-WEAPON
Geopolitical reseacher Galima Galiullina, a doctor of Philospohy with Russian origin but resident in the USA where she collaborates with the Veterans Today website, publishes a detailed article to illustrate the mission of the 122 military doctors sent from Moscow to help Italy overcome the epidemic which killed more than 13 thousand people.
CoronaVirus – 8. Exclusive: “Russian Mission for Cleaning Italy and World from a Bio-Weapon”
It is a unit of experts in NBCR attacks (Nuclear Bacteriological Chemical Radiological) who arrive in the Italian peninsula not only to disinfect the most affected structures such as those in the province of Bergamo but also to research the hypothesis of the biological weapon.
CoVid-19. Wall Street Media’s Analysts Censure News on Russian Mission in Italy
His speech on Gospa News will be subject to a “censorship” with a negative review by a New York-based site financed by Wall Street experts who is persecuting all the counter-information media in Italy and in the world with the excuse of seeking fake-news without providing detailed reasons for the coarse disputes.
9 – THE DANGEROUS SUPERVIRUS FOUND BY CHINESE AND AMERICANS
The video of a scientific transmission of the TGR Leonardo broadcast by RAI 3 in 2015 becomes back viral for the report on the extremely dangerous “chimera” Supervirus built in the laboratory by the SARS CoronaVirus strain that struck China in 2003. The study was carried out by Chinese Wuhan researchers (as accused by Francis Boyle, report 1).
Whole Italy points the finger at China but the American site Veterans Today, taking up an article by Pravda, reveals that the US government agency USAID, often the CIA tool for regime-change in the world, also funded the project.
Pandemic Bio-Weapon – 9. Supervirus Created by US during Obama’s Govt: 89 CoVid Strains in CIA’s Top Secret Tests
Gospa News also focused that the project was created, supported and authorized by the White House during the Obama-Biden administration when lawyer Haines worked in the CIA, before collaborating with Gates and partner universities of one of its private funders. supervirus research.
Virologists deny correlations with CoVid-19 but so little is known about this latter strain of CoronaVirus that the suspicion remains especially after the disappearance of the study of some Indian researchers on the virus create in bio-lab…
10 – THE PROPHECY ON THE NEW WORLD ORDER
The circle of suspicious coincidences closes perfectly with the aforementioned prediction of the former vice director of US counter-espionage in which, during a conference in Camden in 2018, in addition to evoking the threat of the pandemic from a respiratory pathogen, announces the need for a international order.
LOBBY ARMI – 3: TYCOON SIONISTA DEI DRONI SPIA-KILLER PREMIATO DAI MASSONI USA E DALLA REGINA UK
It appears as a clear prophecy of the dreaded New World Order wanted by the Deep International State, the occult ethical, political, financial, military committee in which, in the historical bed of the Masonry Armed (from the revolutionary projects of Giovine Italia-Young America to the agreement OSS-MAFIA-AMGOT in Sicily until the P2-Gladio lodge scandal), the interests of Anglo-American bankers-speculators merge with those of the NATO intelligence deviated apparatuses, of the heirs of the Zionist Movement, including the Sayanim collaborators of the Israeli intelligence Mossad, and those of the Sunni Islamic fundamentalists: from the Salafites-Wahabites to the Muslim Brotherhood.
CIA TOP SECRET FILE: THE US WAR IN SYRIA PLANNED SINCE 1983
Already the specter of a disturbing geopolitical scenario is already hovering that, between the devastating world economic crisis and the countries weakened by the epidemic, could result in the Third World War, initially in a leopard spot like the one that is still devastating Syria since 2011.
St. Pio’ Prophecy on Christians’ homelands, NWO Rockefeller’s abortion law and Masons war
It could begin with a conflict in the Mediterranean and one in Eastern Europe to pursue the common goal of the two components of the Deep State (Masonic deist-atheists and Zionist-Islamist extremists) of the destruction of Christianity and moderate Shiite Islam and the international power which more defends them: Russia, so far the country least affected by the pandemic
Trump kills, Putin and Assad praise Our Lady for Orthodox Christmas in Damascus
We have seen the plots of these subjects of the Deep State, of which a former CIA director of the Dem area has recently admitted the existence, in many other reports on the Lobby of Arms and on the War Zones. But we will see you again in the next on the intertwining between the very dangerous “Made in China-Usa” Supervirus and the Lobby of the Big Pharma of vaccines that bring up to the heart of Saudi Arabia…
N.B. The next articles will be available in the first 12 hours only to subscribers to the Gospa News newsletter who will receive the password necessary for access together with the link to the artic
xxxxxxxxxxxxxxxxx
Wuhan gate. GospaNews
GospaNews
The latest pandemic, the one that the planet is still facing with daily war bulletins that have exceeded the global toll of 67 thousand dead, is certainly the most devastating after the Spanish of 1918-1920 brought to Europe by the Americans soldiers. But behind it, every day that passes, disturbing golden intrigues are discovered …
Gospa News has published hundreds of information and clues useful for identifying the new CoronaVirus as a bacteriological weapon in the 9 previous dossiers, summarized in report no. 10 which highlights the responsibilities of a Deep International State intending to fulfill the New World Order.
Now in this and the next investigations we will reveal the secrets and connections of other research on potentially lethal viruses that take us back to where it all began: in China, once again returned to the circle of suspects after the massacres in Italy, Spain, USA, The United Kingdom and Iran – nations with a strong sovereign orientation of the ruler or emerging political parties – which have far exceeded the count of 3340 Chinese victims by CoVid-19.
That’s why we start again following the finger pointed by the American biological weapons expert Francis Boyle against the province of Hubei: where the prototype of the “perfect weapon” for a biological war was created in that biosafety laboratory 4 around which many varied interests revolve that, as shown, they are not only Chinese but above all of the USA, of the Anglo-American Big Pharma and, as we will see immediately, even of Saudi Arabia.
CORONAVIRUS – 10. The Plot in 100 lines: from CIA Bio-Weapons to New World Order Prophecy
That’s why – like Veterans Today’s military intelligence experts – we believe that the very dangerous chimera supervirus, created by almond-eyed scientists but funded by the government agency USAID, the financial arm of the Central Intelligence Agency, is the “key” with which try to decipher the enigma of a huge fratricidal conspiracy perpetrated by an occult committee of freemasonry, politics, finance and military intelligence.
A Deep State well capable of annihilating human lives such as simple “collateral damage” as happened in the various revolutionary plots of the remote past (France, Russia) and the recent one (Georgia, Ukraine, Lebanon, Iraq) and even more to “sabotage” the geopolitics not only of the USA but also of other powerful states.
That’s why it seems sensible to call WUHAN-GATE this scandal made of intrigues among secret military laboratories grown like mushrooms in the civilian West, hidden scientific documents (but one very important recovered by us), at least three excellent deaths who knew too much about the epidemic, biological vial traffickers arrested in authoritative university centers, disconcerting relations between the supervirus funders and the next speculators on the gold vaccines against CoVid-19.
A virus later renamed by scientists SARS-2 (Cov) for its relationship with the 2003 SARS epidemic, acronym for Acute Respiratory Severe Syndrome (Serious in English).
TOO MANY COINCIDENCES ON SUPERVIRUS “USEFUL BIO-WEAPON”
“Follow the money and you will find Cosa Nostra” is the maxim become legendary of the judge Giovanni Falcone, killed by the Corleone mafia with an explosive mix of military mines while traveling by car with the men of his escort on May 22, 1992 in Capaci (Sicily).
He was killed mainly because, from the Pizza Connection investigation onwards, he investigated together with the Federal Bureau of Investigation on the affairs of the White Collars heirs of the American Crime Union in relation to the torpid relations between politicians, entrepreneurs, mobsters and Masons in Italy. Precisely for this reason, the FBI erected a bust in its headquarters in Quantico, Virginia, in honor of the Italian magistrate martyr of the fight against organized crime.
read more FALCONE-BORSELLINO KILLED FOR MOB-FREEMASONRY INQUIRY
Judging by the repeated sentences of condemnation and compensation for damages imposed on various Big Pharma for serious and dangerous crimes committed in the delicate market of medicines, I believe that the time would be ripe to endow the justice of the aggravating circumstance of the association for criminal offenses of pharmaceutical nature…
If not was that the speculators in this sector are, as demonstrated by the previous report 3 of Gospa News, the same as the Weapon’s Lobby, who have an international license to kill sanctioned by officially democratic nations.
Around the Big Pharma, international research bodies have been born. With the excuse of finding new effective vaccines for the good of humanity they conduct “dual use” studies aimed at that “gain of function” which in the field of biological weapons has the same purpose of the so-called “enrichment” of uranium in nuclear warheads for missiles.
BSL 4 biosafety labs of the Wuhan Institute of Virology in China
The SHC014 supervirus, defined as chimeric because it does not exist in nature but created with biochemical engineering, was developed by scientists in the Bsl 4 laboratories of the Wuhan Institute of Virology managed by the Chinese Academy of Sciences and in Bsl 3 of Chapell Hill in North Carolina University.
Barack Obama’s administration financed the research through the government agency USAID (Us Aid International Development, used in Syria by the CIA to finance anti-Assad rebels) and had allowed it to continue through the National Institutes of Health (NIH) despite the White House moratorium against dual use experiments: the results of which for legitimate scientific purposes can then pose a biological threat to public health and / or national security.
Pandemic Bio-Weapon – 9. Supervirus Created by US during Obama’s Govt: 89 CoVid Strains in CIA’s Top Secret Tests
«The emergence of severe acute respiratory syndrome coronavirus (SARS-CoV) and Middle East respiratory syndrome (MERS)-CoV underscores the threat of cross-species transmission events leading to outbreaks in humans. Here we examine the disease potential of a SARS-like virus, SHC014-CoV, which is currently circulating in Chinese horseshoe bat populations1. Using the SARS-CoV reverse genetics system2, we generated and characterized a chimeric virus expressing the spike of bat coronavirus SHC014 in a mouse-adapted SARS-CoV backbone» is explained in the abstract of the research published in Nature Medicine.
«The results indicate that group 2b viruses encoding the SHC014 spike (…) replicate efficiently in primary human airway cells and achieve in vitro titers equivalent to epidemic strains of SARS-CoV. Additionally, in vivo experiments demonstrate replication of the chimeric virus in mouse lung with notable pathogenesis» noted the study called “Generation of infected VAR clones similar to bat SAR; Laboratory Safety Plan ID: 20145741; Planning ID G: 12279” highlighting the severity of the infection in guinea pigs..
«Evaluation of available SARS-based immune-therapeutic and prophylactic modalities revealed poor efficacy; both monoclonal antibody and vaccine approaches failed to neutralize and protect from infection with CoVs using the novel spike protein. On the basis of these findings, we synthetically re-derived an infectious full-length SHC014 recombinant virus and demonstrate robust viral replication both in vitro and in vivo. Our work suggests a potential risk of SARS-CoV re-emergence from viruses currently circulating in bat populations».
This research warned in 2015 of an “impending” danger but was forcibly created in the laboratory with biogenetic engineering by Crispr-Cas9, the DNA “overlock” kit with which another Chinese scientist, in October 2018, gave birth to the twins with alteration of the genes arousing the indignation of the world bioethics committees.
TRANSHUMANIST CHINESE TWINS “WITH ALTERED BRAINS”
The study was funded by the National Natural Science Foundation of China and the USAID-EPT-PREDICT synergy funded by EcoHealth Alliance (EHA), a global nonprofit organization for environmental health «dedicated to protecting wildlife and public health from emergence of diseases» based in New York which, to protect the “luckiest” animals, financially supports the “slaughter” of laboratory guinea pigs…
As highlighted in the previous report 9, various scientists took care to sanction that between the SHC014 obtained from SARS-1 and the COVID-19 of the current SARS-2 there are relationships but numerous nucleid differences, although in both the “deadly killer” is the “S” Spike protein, abnormally modeled also in the new CoronaVirus according to Chinese researchers.
CoronaVirus BioWeapon – 2. Intel sources: «Spread by CIA with nano-Uav» as Cyber-DragonflEye. Alert in Iran and Italy
However, this does not exclude that that prototype could later be “reshaped” as a bacteriological weapon in one of the many military laboratories in the world, considering that only the USA has 25 research centers in the Pentagon, the Department of Defense, only abroad. In this hypothesis, the presumption of extraneousness of the first researchers is peaceful, but suspicious coincidences and intrigues are starting to be too many.
JOHNSON & JOHNSON’S ROLE BETWEEN SUPERVIRUS AND VACCINE
In report 9 we saw that the two American universities Columbia and John Hopkins are among the partners of the EHA financier in New York with whom the former Obama CIA deputy director Avril Haines collaborates, protagonist of the CoronaVirus pandemic exercise in October 2019 organized by the John Hopkins Center thanks to funding from the Bll & Melinda Gates Foundation after the prophecies of Microsoft’s tycoon on a lethal pandemic.
Today we reveal that Big Pharma Johnson & Johnson is known as one of the main partners of EcoHealth Alliance, known for multiple scandals with judicial implications.
The American pharmaceutical giant was sentenced in October by a Pennsylvania jury to pay $ 8 billion in damages for not reporting that a drug could cause breasts to swell in men, but an Oklahoma judge in August had sentenced him to pay $ 572 million to the state for the multinational’s role in the opiates crisis which, according to US authorities, resulted in 400,000 overdose deaths from 1999 to 2017. Only in Oklahoma, according to state attorneys, about 6,000 died from overdose from sedatives and painkillers.
While in July 2018 a jury in St. Louis sentenced Johnson & Johnson to pay about $ 4.7 billion in compensatory and punitive damages to the women who had sued for the asbestos present in its talcum powder and believed by numerous experts listened to during the process responsible for their ovarian cancer.
The corporate overview of Big Pharma Johnson & Johnson
Let’s make it clear that J&J, supported by the same American investment funds as the Weapon’s Lobby, among which the National Bank of Norway stands out, was not among the direct financiers of the research for the supervirus but is only among the supporters of EHA who financed it. So what is suspect in connection with the current pandemic? It is soon said…
«The U.S. government has cut deals with Johnson & Johnson and Moderna Inc and said it is in talks with at least two other companies to expand manufacturing capacity within the United States for vaccines to prevent the new coronavirus even before safe and effective ones become available» LeaderPost reported several days ago together with many other media.
When J&J announced a $ 1 billion deal with the United States government to create enough production capacity to produce over 1 billion doses of a vaccine, its shareholdings increased by more than 7%. We will see in an upcoming report an incredible speculation started on some European stock exchanges in relation to another company interested in drugs against SARS-2.
Johnson & Johnson had started research as early as January 2020. Janssen research teams, in partnership with Beth Israel Deaconess Medical Center, part of the Harvard Medical School in Boston, had built and tested several vaccine “candidates” using Janssen AdVac technology waiting to know the new coronavirus sequence (COVID-19). Now he has chosen a “candidate” but he will not start testing it in people until September.
J&J effort will be funded in part by approximately $ 420 million from the U.S. Department of Health and Human Services (HSS) Biomedical Advanced Research and Development Authority (BARDA) government agency.
VACCINE RESEARCH FINANCED BY PANDEMIC’S PROPHET GATES
BARDA itself informed Reuters that it also plans to spend an undefined amount to increase the production of the COVID-19 vaccine candidate from Moderna Inc (MRNA) which in March launched the first tests of its mRNA-1273 vaccine on human volunteers. healthy.
As already highlighted in report n. 6, not only is Moderna a company that has grown steeply thanks to the support of the “pandemic prophet” Bill Gates and his international body Coalition for Epidemic Preparedness Innovations (CEPI) who supported it to develop a vaccine against COVID-19.
But it is also subsidized by DARPA, (Defense Advanced Research Projects Agency), the Pentagon agency that studies new potential weapons with the bacteriological testing laboratories opened by the world from the USA through private companies coordinated by the DTRA (Defense Threat Reduction Agency), an another Department of Defense agency capable of processing viruses for different ethnic genotypes through biochemical engineering of genome editing.
CoronaVirus BioWeapon – 6. Prophecy on Pandemic and NWO by Obama-Biden CIA’s Queen
Another American company, Inovio Pharmaceuticals, Inc. (INO), has also just announced that it has started testing its Ino-4800 vaccine on the first 40 healthy human guinea pigs, after which it will proceed to the sick ones to check for any effects. unwanted on both categories.
Also the researches of this company have been supported by CEPI Gates-backed such as that of the University of Queensland, Australia, combined in its project with the notorious GlaxoKlineSmith in which the interests of the tycoon of Microsoft Corporation appear consistent and in which the curious role of the Saudi.
EVEN SAUDI AMONG VACCINES AND BIOCHEMICAL DANGER
Dr Keith Chappell, chief researcher at the University of Queensland, said in an interview with Australian media that a vaccine could be ready for human tests by mid-year.
«In our best-case scenario, we aim to have a material ready for dosing humans in 16 weeks. We have shown great success with a number of viruses and we have people and systems in place to be able to move very quickly» he has declared. The innovative process allows you to develop a vaccine without using a live form of the virus, thus ensuring a much faster multiplication of doses.
«We take that DNA sequence and produce a protein that’s the same as what’s on the surface of the live virus» it is integrated with an adjuvant: an immunological agent that helps create a stronger immune response.
Just the experience of GSK, leader in vaccines but also in adjuvants, is fundamental for the success of the research supported by the Australian government with 3 million dollars.
Among the most significant partners of Big Pharma Glaxo, shareholded by the investors of the Weapons Lobby as highlighted in report 3, there are also Muslims. The British multinational has in fact established Glaxo Saudi Arabia in 1992 together with Banaja KSA Holding.
Saudi Crown Prince Mohammed bin Salman
«Healthcare is one of several sectors the kingdom wants to reform under its 2030 plan to diversify the economy away from a reliance on oil under plans instigated by Mohammed bin Salman, its crown prince».
Times reported it in 2017 giving news of the large bet carried out by GSK which had increased its share in the Arabian Peninsula branch from 49% to 75% after the arrival of the new CEO Emma Walmsley, non-executive director also in the Microsoft Corporation as discovered by Gospa News.
CoronaVirus BioWeapon – 3. GSK Golden Vaccine’s Ring with Bill Gates, Pentagon and Zionist’s BlackRock
The Saudis are among the few governments to have so far gained from the pandemic thanks to their conventional oil which has put out of the market the shale one of American production, subject to such extraction costs as to be advantageous only if crude oil costs more than $ 50 a barrel.
But the role of Riad in epidemiological research has also been significant in other areas. Among the partners of the NGO EcoHealth Alliance (EHA) of New York that funded the search for the dangerous chimeric supervirus SHC014 there is also King Saudi University, the first public university of the kingdom, founded back in 1957 by King Saud bin Abdulaziz right in the capital and provided with a prestigious College of Pharmacy.
GSK IMMUNIZATION PLAN IN ITALY FINANCED BY RIAD
Not only. The Saudi Kingdom, today worried about the risk that the SARS-2 epidemic could affect 200 thousand people as happened in the US, was one of the first supporters of the vaccine VPDs (vaccine-preventable diseases) Immunization Action Package launched in 2014 by Global Health Security Agenda (GHSA), partnership between 67 nations of the world to accelerate specific plans of the World Health Organization.
That epidemiological prevention plan had chosen Italy as a pilot country in a synergy between the Democrats of the Barack Obama government in Washington and that of Matteo Renzi in Rome which materialized with the Lorenzin Decree on the 10 mandatory vaccines for school attendance (6 more than before) approved in 2017 by the Italian parliament.
But already a year earlier GlaxoSmithKline had bet on the project, as if it were certain of its approval and to receive the assignment for the supply of vaccine doses, doubling the laboratories especially in Tuscany, the historic red-left region governed by the Dem where in May, if pandemic permitts, elections are scheduled for the renewal of the regional administration.
CoronaVirus – 1. “IT’S BIO-WEAPON”. Us Expert blames China but forgets 25 Pentagon’s Secret Labs for “Ethnic Attacks”
As highlighted above, 2017 was also the year in which GSK reinvested in Saudi Arabia part of its annual turnover of 28 billion dollars which subsequently increased in Europe, and in the vaccines sector in particular, by 21% (1.2 million dollars between 2018 and 2019) also thanks to the Global Health Security Agenda immunization plan.
So here is an extremely swirling but even a little suspicious business pinwheel given the multiple connections between Saudis, GSK and the latter’s research for the US Pentagon highlighted in reports 1 and number 3. But also for another sensational coincidence …
A third country subsidized the GHSA international vaccine project: the Republic of South Korea.
The Immunization plan of the Global Health Security Agenda
The South Korean nation was one of the first to be reached by the pandemic in January but in the final budget it recorded 10,284 infections from CoVid-19 and only 186 died against the 15,889 deceased in Italy (WHO data report 77 of 6 April ), where the Decree on the 10 compulsory vaccines for children aroused protests from pediatricians, concerned above all by the hexavalent (six in one fell swoop for children aged 1-2 years), and the spontaneous NO-VAX committees.
In Rome, GSK was in fact well known for the implication of its conglomerate SmithKline in a story of bribes that resulted in the conviction of the former Minister of Health Francesco De Lorenzo who instituted the mandatory vaccine for Hepatitis B.
SARS-2: for defending “Bilderberg’s Fake News” Italian Govt Blames Russia wich Helps It
That’s enough for this first episode of WUHAN-GATE. In the next one we will talk about the unknown sample of CoronaVirus found in the lungs of a Saudi patient on which a scientist who died mysteriously …
Hoping that Jesus Christ and Saint Anthony of Padua have protected us until then from the biological weapon CoVid-19 and from the conventional ones: to which has now been added that of the state censorship wanted by the Italian Democratic Party, well look at that vaccines’ fans…
Fabio Giuseppe Carlo Carisio
© COPYRIGHT GOSPA NEWS
no reproduction without authorization
xxxxxxxxxxxxxxxxxxxx
George Webb
Reddit posted Mar 30, 2020
Video Speech to Text translation, with corrections and adaptation to a standard document format, by Stephen Francis
This is going to be about the coronavirus timeline. We had a distinguish author here yesterday saying what you need to do is lay out a coronavirus timeline so that everybody can follow all the stories that are circulating around coronavirus.
So that's we're going to do, but first, we're to go all the way back to Frank Palmer, and doctor K and Doctor Q in Winnipeg.
So we're going to cover that, but first I want to give people an idea of why I said about Macha Benassi or Mat Benase who both went to the Wuhan Games, were patient zero and why Macha Benase was patient zero.
Remember the Chinese government believes it's the athletes, the three hundred athletes.
We looked at NATO, her relationship to the Four Star General, but remember on our Channel we've been following Fort Detrick going all the way back to transport Logistics nukes and bio diversion.
So we've been following that. We've been following the use of these NATO Blackberries. Been following Peter Strozk for three years and we've been looking at the task force and I went up to Bethesda Hospital many times if you remember we looked at the FDA there we put that the NIH.
We looked at people who had infiltrated those organizations, around that different coding products those companies used. We've done a lot of background on Bethesda Hospital many times if you remember, we looked at the FDA ...we looked at the NIH ...the people who had infiltrated those organizations....the different coding products...we've done a lot of background on Bethesda Hospital ...
but if you look at see who first of all you have to be aware of the World Health Organization. You probably are aware of this guy who is Ethiopian now who's running the World Health Organization who said how virulent this strain and caused a little upset, so we'll just call him President E for Ethiopia doctor for right now ... Doctor E is the one from World Health Organization that talks about the virulence of this strain.
I believe he's right if you consider all five groups of the strain. So WHO has these centers called WHO Collaboration Centers.
So they're basically like task forces much like we have Task Force Orange where you bring Navy guys, Special Forces folks FBI like Peter Strzok.
DTRA with a classic example of people that move these bio, chems, and nukes. Defense Threat Reduction Agency is a perfect example of people coming from all different angles of a problem to form a task force. Part of the reason we called task force task force and she was studying that's okay,
so, if you look at these World Health Organization collaboration centers, there's very few of them in the United States and there are built around where our current biology safety lab Force are built so the PSL force. One of them's in Winnipeg, Canada, there's several in the US, but there's only three I believe WHO Collaboration Centers. If an outbreak of a weapon may be involved you would typically go to the BSL-4 level places ...Fort Detrick, Galveston Texas, Fort Collins, Colorado etc.
If you really wanted to see where an international group may have met in planning a bioweapon deployment, it would be in a WHO Collaboration Center, so we're talking about seven or eight of these BSL-4 (safety level four)where these viruses are kept most secure facilities. Remember Fort Detrick closes in August of 2019. We'll get to that.
You look at those three centers Bethesda, Galveston, and Fort Collins, the WHO, the ones we've really focused on, was Bethesda. That's where we went all the time, that's where we were doing all the research, infiltration ..etc.
Now if you look who is on the WHO CC, you'll find, not Macha, but Ada Bennaci.
Now, it just strikes me, the reason we held this back, was we didn't know if it was Nach? Bennaci or Macha, husband and wife, both in the military at Fort Belvoir. She works at Fort Belvoir community hospital. So, that is not just two cyclist from the Armed Forces going to the Wuhan games but we're talking about the WHO CC, okay, now that's one of three military deployment centers and reaction centers to virus outbreak, specifically the Bethesda location is four virus deployment and outbreak and response. So here we have A Bennaci. I believe its Mat not Machia. We know that he's on the Bio weapons deployment task Force at that site. Now that would be key thing. Remember there's an Event 201 that happens at ??? and it's about coronavirus the same day the military games are launched to this event 201 launched in New York the same day the opening ceremonies in Wuhan the military games.
Okay so this certainly would have been on to mind of anybody at that center and if either Mat Bennaci or or Matcha was in those meetings at WHO CC, they would have gone to Wuhan with that knowledge in mind. They would have gone to Wuhan with the knowledge that there was a bio attack possible.
Okay remember, this is the group, The WHO CC that would have planned the input, and there was several people there for on that collaboration group at them up at Event 201. So those people either Matt or Matcha, husband and wife team, both army officers, both at Fort Belvoir, where we had an outbreak, both going to Wuhan from The Who CC.
That's huge, That's not just a cyclist who feels out of breath and weak and is leading the first two laps of a race and then collapses from exhaustion on the third lap when she's leading and gets hospitalized to move on. That's not just coincidence. She's on the virus, she or Mat or Mot is on the virus outbreak team at Bethesda.
And now we followed it up from there. We took Glen Bracken??? advice ...we actually interviewed two people, well, two interviews yesterday. One was a person who had been offered a experimental medication at the Bethesda Naval Hospital, this was back when it was Walter Reed, but it's been long known as a place for medical experimentation.
We also interviewed a driver at Fort Detrick. We know, for shipping the big materials ...contractors ship that equipment. ship that material like transport Logistics.
We've connected transport Logistics to LaFarge, and this dark hand of NATO for long time, for three years. We're not guessing. It's a contractor who's has access to biological, chemical, and nuclear shipping. We've done three years and I've gone to all the trials and done all the research on transport logistics and connections to LaFarge.
So I'm not lashing out at transport logistics, I'm just saying that this is something that we know contractors are allowed to do. If you're allowed to move the most sensitive highly enriched uranium, and I sat in trials and listened how they did that. The same DTRA contractor, the same group to move these materials. Now now I just want to get that out of the way
Now I want to go to the timeline. I want to talk about some of the theories. Again, they are not conspiracy theories because again we're trying to figure out what happened to our country. We're trying to figure out what happened, so it's like Columbo, he's trying to solve the murder he's not a conspiracy theorist. he's doing working theories. He's trying to find out what happened.
So let's go to Frank plumber. So Frank plumber at the Winnipeg facility, Canadian scientist, did a lot about SARS and how how to solve the SARS. He was very involved in AIDS. He was one of the key doctors that enabled AIDS to be conquered. If you look at this virus, it's a combination of SARS and AIDS.
Now, we know that in July of 2019, So he dies in Kenya last year. What what happened to the notebooks? What happened to his notes on SARS virus what happened to his notes about HIV, what happened to his ongoing work that was going on at Winnipeg? So we have two doctors, husband and wife team, again. Doctor K, Doctor Q, I'm using just the first letter of their first names just to keep things easy.
So you have Doctor K and Doctor Q, they are escorted by the Royal Canadian Mounted Police out of the facility for some reason. Okay, with 22 missing viles. If you want more on this you can look at BrassBalls.com.
Harry the Greek has the story on Winnipeg ground ground zero. But there was a whole bunch of stories mistakenly connecting Winnipeg directly with Wuhan. And those stories been knocked down now for the exact reason we talked about it.
Fort Detrick, you can't just take 22 vials, these doctors, and fly to the fish market and move on and dump the viles on the shrimp at the fish market and have a full worldwide deployment of the virus. That's not how you vector a virus. That infects a very few people going to the Games, some people would get hospitalized. it would be very localised to Wuhan. In order to maximize your deployment do you have to have what's called vectors, the virus.
You have to have a storage method. You have to be able for it to sit on a shelf like Coca-Cola. It's gotta be refrigerated so the vials have to come down from Winnipeg. Let's say from July they're released out of the facility there so they have the recipe, if you will, sort of like a Coca-Cola secret recipe. I suggest you come to Fort Detrick. What Fort Detrick does is amplify and weaponize, to fully build out the deployment.
They work on two vectors so let's just say it's going to be Coke or vitamin water or some products going to be refrigerated and then you have to get over to the games. It has to be in officially sponsored product, okay, so I don't know if it's possible to do in a dry product like vaping products. We had a lot of deaths in the south Florida, Georgia with the vaping products with most of the concentration was around the CDC in Atlanta.
We know Rod Rosenstein's wife Missoni, who was first to attack Trump on that. But in order to amplify a product, okay, once you have the recipe coming down from Winnipeg, you need to amplify the product. That would be done what's called a Polymerase Chain Reaction machine.
Basically you heat the virus up so that it separates, you copy the RNA. You cool it and then hit reforms and then you do that like a lot. So that's how you get a lot of virus. You amplify the virus to a full buildout. okay.
Now you've got a bunch of viles of the syrup. So I'm just going to stay with the Coke analogy for a second to make it easy.
This syrup has to be refrigerated, remember, but you need to test it, you need to test it before you send it to Wuhan. remember now the CDC is the same people that brought you all the venereal disease testing in Atlanta and a lot of testing since then. So again, you only need one person. I'm not saying it's Missonier??? You only need one or two people to get the pathogen out of the CDC to do the testing.
Remember the CDC's covering this up right now. Redfield covered it up. He called it a mystery pneumonia. Very coronavirus-like, okay. Originally had said these are flu deaths. The CDC mischaracterized them as mystery pneumonia. They haven't said those were coronavirus, yet but I believe that especially the Georgia and Florida vaping deaths could have been from vaping. They figured out a way to do a dry vector.
I figured out a way to do a dry vector. Dry vectors are really hard, it's much easier to do a a refrigerated vector like Coca-Cola. The only difference being that the syrup would need to remain refrigerated.
But you need to get to a bottler. You know you need to get this to Coca-Cola China. So you need to fly it up there. It is again, weapons-grade bioweapon. Again the only way to do that would be DTRA again.
Now you could ship it. I doubt it because the refrigeration needs. You fly it to usually military bases. There's a cooperative agreement between all these Air Forces for each other's military bases and then get it and get it brought in to Wuhan.
Now the best way to do it would be under the cover of one of the official sponsors for the games. The problem and deployment is you have to have a sponsor. They control the water the athletes drink very carefully they control the clothing the athletes wear very carefully.
So, two ways they could vector, right, first thing is you don't want to deploy the vector at the beginning of the games. If you do that at the beginning of the game, people will start getting sick and then they'll be world press coverage. With all the Press there to cover the event, it'll say oh outbreak in Wuhan. The whole world will know about it and then they'll start checking people coming back from the games we won't be able to get back in the country. And they will quarantine them. I'm not saying you are Peter Strozk. If you are a Peter Strozk-thinking-like person, you want to make sure you get full deployment.
You want to deply the vector on the last day of the games, so people aren't showing symptoms. It is very cold here this morning, my eyes are running so I'll be the the person arriving back in Milan from the games.
So that's why I'm saying it has to be an officially sponsored product. Either the clothing, that you would spray a dry cleaning fluid on a clothing for the final let's say for the for the final march or some type of drink like vitamin water or some type of bottled water at cetera commemorative for the closing ceremonies what happened toward the end of the games okay.
So remember, you can't take the stuff on the airplane so it had to happen before the closing ceremonies and you have to put people on in order to get a hundred countries plus, it would have to be deployed that last day.
Now. Ther person who runs the World military Games Association just happens to be in Italy and a lot of the clothing manufacturing was done in Milan even though the company was Spanish, it was a new vendor for clothing.
Let's just do the athletes clothing for the closing ceremonies was Kelme. It's actually one of the places on our Paper Clip pipeline out of Malta after the second War World War.
But a lot of the clothes were made in Milan. Most people don't know, but Milan is 20% Chinese. So not only do you have a whole bunch of Chinese people, and I'm not saying Benacci was a part of it.
He was communicating with China, this is Benny Benassi the DJ for Madonna. I don't know if you went but he was communicating with someone in China.
But you have all these Chinese workers doing all these outfits. You have to still go to China to have to do the outfitting of the clothes and then you would just be spraying the clothes right before the opening ceremonies to maximize the mist that would come up and close and infect everyone in the stadium. You could also, I doubt the Chinese would not know this but you could also just do drones. If this was a part of the show I use you can just basically use the drones.
The point is a tough question. Deployment is a tough question it's it's hard but I I would say the clothes were people touch their clothes then they touch their face is probably the vector that makes the most sense Vector that makes the most sense because well I guess that's that's how I would do it and that's what actually happened all these Chinese workers went from Milan to Wuhan, they did the clothing thing. They came back to Milan and that's where the biggest outbreak is.
So they would have been the ones handling the clothing, for doing the measurement, trimming, and fitting the clothing Etc.
Some people are saying it was the water. I'm not ruling that out I'm just trying to work within the metadata. You have to make the the crosshairs fall over Milan and the Chinese workers in Milan. If you if you drop down with all these deaths that are happening, 919 deaths in Italy. It is a hotspot that you the snow typhoid pump, if you will, for example, going back to the English epidemiology example is in this garment district in Milan.
Remember, Doctor Snow was a layman and figured out Cholera epidemic. By putting pins on a map and say it was the pump it was a pump handle for this pump it was bringing this fecund water from the Thames. A layman can solve these but you have to go to data.
You can't deviate from the data you have to look at the Garment District in Milan and you have to look at the Garment workers going back and forth as the key linkage in this story
Where was mplified, I don't know. If it was amplified at Fort Detrick, I just know if it was amplified by Fort Detrick. I just know that Fort Detrick was closed a month later after Doctor and Doctor K were kicked out.
Now interesting enough, normally when you steal 22 viles out of a bio lab especially for level four bio lab you go to jail, but that's not what happened with Doctor Q and Doctor K.
They actually went on a speaking tour in China talking about Coronavirus in preparation for the corrupt coronavirus deployment. It was almost like they wanted to minimize the impact in Wuhan again working with the NATO allies potentially here, minimizing the impact.
I'm not seeing it working for China. All indications lean more toward a NATO Strozk-type conspiracy than a Chinese conspiracy. But again you have to look like Coca-Cola bottling or a massive project where you're making a whole bunch of spritzer, where they are puting on the clothes, and then have to be in an environment where everyone's very tightly packed together like a closing ceremonies parade in a very large Stadium where people are not going to think it's odd to have drones, you know, was a part of the show etcetera, they may have to be comfortable with being sprayed on.
if you go back to Benny Benassi the DJ for Madonna, he has a lot of these events were they have drones over the audience and they blamed vaping. It's not they haven't figured out how to do dry better that's just draw whatever it is.
I tend to think that is more conspiracy theory. You've got to follow the Chinese garment workers from Milan to Wuhan, that's the critical link that you can ignore.
So I'm going to leave it there I'm not going to talk about Dr. Plumber and him dying in Kenya again a bad country to travel through if your Strozk. if you can see if you're trying to solve Strozk's illnesses.
Remember, if you try to solve these problems you have to go with people who've already done it. You have to look at Catholic Family Services in with Peter Strzok Sr. in Haiti for the deployment of bioweapons in Haiti.
You have to look at Africa, you have to look at Kenya, and Tanzania. you have to look at these bombings different deplyments. I just want to get away from this rock throwing by the by the popular press I may have overreacted a little bit to the Forbes article I may have overreacted to the Vice news but it's much like the New York Times it's this immediate rock-throwing are conspiracy theorists, I guess are right wing that's conspiring with the Chinese, how does that work ever given money to other than Rand Paul is Bernie Sanders so again it's it's it's not helpful to look at the actual data and look at the past history at the past black hat it again how is Benny Benassi top DJ married to the to the crime unit guy Leschenko??? that did the dossier and did the black ledger against Paul Manifor?
I just find that a very tight connection. I don't know who the official sponsor was for for the Coke or the vitamin water or the bottled water and that would be another interesting factor because it would need to be refrigerated. But remember, We have a dry cleaning expert here believe it or not. I'll talk to you about chemicals used in drycleaning. That could have been the vector. Again, you want to make sure you clean it. If the athletes war it in the opening ceremony, you don't want them wearing stained clothing in the final ceremonies, so would have an opportunity to dry clean them to add a chemical.
So you would get by the initial screening. If you remember Rod Wheeler talking about screening food and and food and Drug so forth way back when in the end of the evolvement of DHS in the United States. You would get past the initial screening everyone's comfortable with their clothes now that they've been wearing every day and now here come the last things you wear. Remember you don't want the outbreak while you're there.
So, to wrap up, it wasn't just idle speculation we've been following this DTRA diverting nukes, chems and bios for three and a half years now. We've been following Strzok and methodology used with these NATO Blackberries, remember, again, military grade encryption of these phones.
Remember, these military grade bioweapon, military grade uranium. What's the common thing here? Military-grade is the common theme. Remember we identified Dymitry Faravich with military grade cyber hacking tools.
Again, I see the reaction of each of the CDC. Again, this isn't about the Trump administration. These are the people. It's very similar to the Crowdstrike coverup.
You would think with a worldwide bio attack or just an outbreak, you would want to know everything there is to know. For all the you know this is like doctor finding the cause of Cholera when everybody's dying in London it's helpful it's helpful to say hey. Being transmitted the waters to keep the water in the Thames is fecund we have to we have to clean up water and led to sanitation what led to a lot of improvements in a lot of people not this is a helpful activity.
All my family have been trained their whole life to be involved in medicine and Public Health in the poorest neighborhood so it's not something I don't have a track record. I'm not a conspiracy theorist I have someone who's trying to help find solution thank you.
I'm not a conspiracy theorist. I'm trying to find a solution. Thank you so much.
COVID-19 ... MilleniumReport
STAGED CORONAVIRUS PANDEMIC: An International Criminal Conspiracy of Epic Proportions
CORONAVIRUS,
CHEMTRAILS,
VACCINES,& 5G
The Most Premeditated and Highly Organized
Depopulation Scheme in World History
Wuhan coronavirus pandemic STAGED to cover-up the
public health crisis caused by the intensive 5G roll-out
in Wuhan City in 2019
SPECIAL NOTE: It’s of vital importance for every bioweapon expert, medical researcher, bioengineering scientist and investigative journalist to comprehend the true complexity of this global depopulation scheme and major move toward global governance. That’s why the following extensive report is a very long read indeed, which will get even longer with each successive update. The Wuhan coronavirus pandemic is actually an immense and convoluted series of black operations that are taking place on several levels each with multiple layers, in different dimensions and on every continent. This is not 5D chess, it’s 12D chess; and it’s been planned for many decades for this very moment in time. Only with this correct understanding will folks come to apprehend how various furtive operations, which appear to be working at cross purposes, are really overseen by the same plotters. Some of the most weighty explanations articulated below may even seem to be mutually exclusive—they are not. Some of the most radioactive info/data is only now being emailed to us as it will continue to be for the foreseeable future; after all, the more time that goes by, the more the hard truths will surface. Therefore, it’s the “Updates” posted at the bottom of this page that will contain the most current and sensitive intelligence. The final point here is that “staged” does NOT mean this is a hoax; only that many pieces of this op are choreographed and carried out to have maximum effect on the targeted populations.
State of the Nation
QUESTION: Is the bioengineered coronavirus pandemic being purposefully propagated globally in order to further facilitate the military deployment of 5G worldwide?
The answer to that critical question is of paramount importance to every person on the planet because of how forcefully the 5G juggernaut is rolling across the land.
We all knew they were going to do something big—VERY BIG!
But the rapidly unfolding depopulation scenario that utilizes the Wuhan coronavirus, 5G, forced vaccinations and chemtrails is quite ambitious by any standard.
5G Roll-out
There’s nothing more sacred to the implementation of the New World Order agenda — WORLDWIDE — than the meteoric military deployment of 5G and subsequent build-out of the Internet of Things (IoT).
Truly, this absurdly impossible project represents the capstone of the nefarious NWO conspiracy to stealthily inaugurate a One World Government.
Nonetheless, the NWO globalist cabal has gone completely mad and they will try whatever they can to set up their long-planned Global Control Matrix, which requires a fully operational 5G energy grid as a prerequisite to a fully functioning Internet of Things.
Wuhan City was established as an official 5G Demonstration Zone in 2019. The Chinese government planned on using that major metropolis as a showcase for all the ‘dazzling’ benefits that a 5G energy grid is supposed to offer wireless IT users. Then they planned on setting up Wuhan City as an urban flagship for the Internet of Things.
Wuhan City Was expected to have 10,000 5G base stations operating by the end of 2019
Make no mistake about it: The activation of a major 5G energy grid in a megalopolis like Wuhan City will inevitably have HUGE health and environmental impacts.
The second they flipped the switch on 5G in Wuhan, the entire populace was immediately exposed to extremely harmful electromagnetic frequencies and microwave radiation.
In point of fact, the specific radio-frequency signal ranges and microwave radiation output necessary to power up a working 5G power grid are well known to be inordinately unsafe and dangerous to human health. As follows:
MILITARY INTEL REPORT Proves Government Has Known 5G Radio-frequency Ranges & Microwave Radiation Are Harmful to Human Health
Not only has the U.S. Military scientifically documented the adverse health effects associated with 5G (as well as 4G and 3G), there is now hard evidence that proves the U.S. Federal Government has knowingly lied about those numerous health hazards for decades. As follows:
Hard evidence proves US gov’t lied about 5G. Navy research report confirms numerous health dangers.
Which brings us to the single most perilous aspect of the military deployment of 5G—KILL ZONES.
All the scientific evidence available in the public domain now indicates that wherever 5G infrastructure is located in the greatest concentration generating the most powerful EMFs and microwaves, those 5G Super-Hotspots will effectively function as kill zones. As follows:
5G Super-Hotspots: You better know where the “kill zones” are located!
In order to fully grasp the highly destructive and deadly potential of these rapidly emerging 5G Super-Hotspots, the following video exposé presents a scenario where the most powerful “directed energy weapons” will be located within these 5G kill zones.
5G WEAPONRY: Microwave Radiation Technology Being Deployed as Depopulation Warfare, Full Spectrum Dominance & Total Human Control (Video)
ISRAEL: World Headquarters for the 5G Roll-out
Now, this is where the plot thickens.
The Zionist Government of Israel has made it a global mission to commandeer the military deployment of 5G throughout the world community of nations.
Because the future capital for the planned One World Government is Jerusalem, the ruling Zionists know that they must control the entire 5G roll-out, just as they are presently (and unlawfully) doing in the USA. There is no greater promoter of 5G than President Donald Trump, which is why he has even stated with great pride that he can’t wait for 6G in the United States!
All of this rabid 5G development and IoT build-out surreptitiously overseen by Tel Aviv demands an answer to why 5G is not permitted in Israel.
Answer: Here’s why 5G is NOT allowed in Israel where it was developed
There’s only one way to correctly comprehend the pivotal role that Israel plays in the emerging New World Order. The rogue, criminal, apartheid State of Israel was literally created as the global headquarters for the Khazarian Mafia high command. Which begs the question:
How, exactly, was Israel established and empowered over the course of the 20th century?
This is how!
By way of the
Armenian Genocide,
World War I,
Bolshevik Revolution,
Spanish Flu Genocide,
The Great Depression,
World War II,
The Holocaust,
9/11 Terrorist Attacks,
and the War on Terror
which all have one thing in common.
Israeli Zionism
It’s entirely true that: “Each of the above-listed cataclysms was stealthily carried out to create the modern State of Israel and/or to greatly advance the clandestine Greater Israel project.” (Source: The Secret Agenda Behind the Trump Mideast Peace Plan)
Huawei
When you follow the BIG money behind Huawei, it becomes clear that the largest Chinese multinational technology company is really owned and operated by the International Banking Cartel.
It’s crucial to understand that “Huawei has deployed its products and services in more than 170 countries. Huawei overtook Ericsson in 2012 as the largest telecommunications equipment manufacturer in the world, and overtook Apple in 2018 as the second-largest manufacturer of smartphones in the world, behind Samsung Electronics”.[1]
Publicly-traded corporations the size of Huawei are only permitted to acquire so much market share with the blessing of the International Banking Cartel (IBC). The IBC is in turn overseen by the Khazarian Mafia whose headquarters happens to be in Tel Aviv. This is precisely why China was awarded Israel’s Port of Haifa contract in 2019 which will actually force the U.S. Sixth Fleet to dock elsewhere. See: How did China ever win Israel’s Port of Haifa contract over the US?
The relatively hidden state of affairs between China and Israel has obscured the profound influence that Tel Aviv exerts over Beijing. That well-concealed relationship developed as a result of China being released from the throes of the Cultural Revolution that ended in 1976 when it was permitted to transition to a market-oriented economy by the International Banking Cartel.
“Since the introduction of economic reforms in 1978, China’s economy has been one of the world’s fastest-growing with annual growth rates consistently above 6 percent.”[2]
The deal that China made with its secret masters in London and New York City is quite similar to the one that President Boris Yeltsin made with the very same banksters (IBC) which covertly approved the Fall of the Berlin Wall. Both Presidents Gorbachev and Yeltsin were only able to facilitate the liberation of Russia from the Western-installed communist regime that ruled the Soviet Union by agreeing to a new form of “Rule by Oligarchs”—Western controlled oligarchs. Except that Vladimir Putin patriotically reneged on those plunderous agreements in the interest of “protecting Russia”. See: Secret History Revealed — Putin Played Critical Role After The Pre-Planned Collapse Of The USSR
However, in the case of China, what was imposed by the Western banksters was a novel form of predatory capitalist-imposed slavery after the yoke of communism was removed by the IBC. That’s why there are so many sweat shops all over China today. That’s also why 5G has been rolled out in some of the largest Chinese cities without even an iota of safety testing. Powerful transnational corporations (like Huawei) have been granted slaveowner power by the IBC to run corporate plantations all over China.
COMMUNISM: A Jewish Creation for World Takeover
The essential point here is that communism was first used by the banksters in China (and Russia) to establish an enormous archipelago of concentration camps for slave-workers nationwide, which were then converted into corporate plantations after the entirely staged ‘fall’ of communism. For example, Apple, Inc has been frequently blasted for running inhumane factory operations (aka sweatshops) which depict the corporate plantation conditions.
Why China?
Who can debate that the Trump administration has harassed China as much as they have tormented Iran? What follows is the short list of some of the worst transgressions the Neocon Zionists in the White House have committed against China.
In light of the US-staged Hong Kong protests, U.S. tariff regime against China, threat of economic sanctions against nations working with Huawei, CIA-inflamed Xinjiang conflict involving the Muslim Uyghurs, provocative sailing of US Navy warships through the Taiwan Strait, transparent political prosecution of Huawei’s CFO, ravaging of China’s pig farms by another DARPA-bioengineered animal virus, FedEx thwarted multiple sensitive deliveries to China in 2019, etc. the Chinese government has been under withering attack since 2018.
(Source: OPERATION CORONA BIOTERROR)
All of this bellicose behavior was directed toward softening up the Chinese government. Not only does the Zio-Anglo-American Axis demand that Beijing submit to its will, they will not stop their provocations until they do. The West has always treated the great nations of the East worst than stepchildren, and that will likely never change. Which is precisely why everything points to China being used as the primary NWO laboratory for the insidiously expanding totalitarian technocracy before the new lab procedures are exported to California and elsewhere around the globe.
*The Chinese people are exceptionally computer literate, digitally connected and hooked into the wireless paradigm—to their great detriment. Many years of exposure to these destructive energies have addicted them to their various information technologies and devices. It has also rewired their brains in ways they are totally unaware and quite damaging. The same is true in every other nation on Earth where technology rules, but the Chinese are extreme in this regard.
The most precarious aspect about the smartphone culture is that many Chinese are susceptible to psychogenic disease and illness, injuries and imbalances. Of course, these are not limited to physical conditions; they are also being subjected to directed frequencies which will cause serious psychological disorders. This may be exactly what’s going on right now in Wuhan where many folks might be triggered via their smartphones, particularly after the city-wide PTSD resulting from so much coronavirus uncertainty and inevitable mass anxiety.
It should also be noted that the countless techies in this type of IT society have never lost control like this. In view of the double whammy of the coronavirus scare and 5G activation, many have been through an unparalleled “shock and awe” experience. The resulting trauma has put many on edge—LITERALLY. Hence, it now appears that many folks in places such as Wuhan can be triggered quite easily via their smartphones without even knowing what’s happening. They can be walking along and suddenly just hit the ground; some even dying on the spot.
The upshot of this discussion is that the NWO controllers are pushing the edge of the envelope with regard to experimenting with sophisticated psychotronic weaponry that is both harmful and deadly. In the present case, Wuhan is their laboratory and the Wuhanese are the lab rats. There are other cities in China which are also being exposed to their own unique set of laboratory conditions.
China is also the premier national testing site for the infamous social credit score system– yet another oppressive control mechanism that the globalists will roll out worldwide when it has been perfected there. The fact that the Chinese government has colluded with the globalist cabal and permitted the citizenry to be abused in this way greatly contributes to the notion that Israel owns China — lock stock and barrel — just as the Zionist banksters did during the days of Red China.
COMMUNIST CHINA: Established by Jewish Revolutionaries and Banksters
Wuhan: Ground Zero
Wuhan, China was specifically chosen to be ground zero for both the 5G roll-out and the coronavirus pandemic. No one can dispute that Wuhan City has been transformed into a desolate, dystopian 5G demonstration zone where the citizens are literally being used as guinea pigs. As far as the 5G scientists in Israel are concerned, all Chinese citizens are nothing but chattel and, therefore, usable (and expendable) in any 5G experiment they set up there.
Why is Huawei setting up 5G base stations all over Wuhan to help fight the coronavirus?
However, these cruel human experiments involve much more than 5G and the coronavirus; they also make use of chemtrails and specific types of industrial pollution generated throughout Hubei Province. China has a well established reputation for wanton environmental degradation, and Wuhan will surely become a post-apocalyptic wasteland when they are finished with it. See: What in the world are they spraying all over Wuhan City?
Known as “China’s Thoroughfare”, Wuhan occupies a very special place in Chinese history as well as in regard to the astonishing economic boom occurring since the mid-1970s. Whatever happens in Wuhan can deeply affect the rest of the nation as the coronavirus panic has graphically demonstrated. It’s as though the producers of this ‘disaster movie’ quite intentionally chose the capital of Hubei Province to be the epicenter of their NWO horror flick so that all of China would tune in. And so they have!
Wuhan today is considered the political, economic, financial, commercial, cultural and educational center of Central China.[17] It is a major transportation hub, with dozens of railways, roads and expressways passing through the city and connecting to other major cities.[23] Because of its key role in domestic transportation, Wuhan is sometimes referred to as “the Chicago of China” by foreign sources.[3][4][5] The “Golden Waterway” of the Yangtze River and its largest tributary, the Han River, traverse the urban area and divides Wuhan into the three districts of Wuchang, Hankou and Hanyang. The Wuhan Yangtze River Bridge crosses the Yangtze in the city. The Three Gorges Dam, the world’s largest power station in terms of installed capacity, is located nearby.
While Wuhan has been a traditional manufacturing hub for decades, it is also one of the areas promoting modern industrial changes in China. Wuhan consists of three national development zones, four scientific and technological development parks, over 350 research institutes, 1,656 hi-tech enterprises, numerous enterprise incubators, and investments from 230 Fortune Global 500 firms.[24] It produced GDP of US$224 billion in 2018. The Dongfeng Motor Corporation, an automobile manufacturer, is headquartered in Wuhan. Wuhan is home to multiple notable institutes of higher education, including Wuhan University, which was ranked third nationwide in 2017,[25] and the Huazhong University of Science and Technology.[3]
Coronavirus
Into this Kafkaesque context, enter the fastidiously bioengineered Wuhan coronavirus. There are several high-integrity authorities, as well as scientific research studies, which have described what makes this unusually fatal virus a lab-produced bioweapon. As follows:
CORONAVIRUS BIOWEAPON UPDATE: Unique HIV-1 Signatures Confirmed by Team of Indian Scientists
WUHAN CORONAVIRUS BIOWEAPON: Bioengineered with Virulence Associated Protein (Video)
There’s no question that this bioweapon was purposefully bioengineered to target the indigenous Chinese people. In particular, individuals born from that traditional Asian gene pool and bloodline are affected much more profoundly by coronavirus infections. See: BIOWARFARE: Wuhan Coronavirus is likely another race-targeting bioweapon strategically unleashed throughout China by U.S. military labs
This deliberate racial targeting by the Zionist perps in Israel is being conducted with certain objectives which are well beyond the scope of this exposé. Suffice it to say that what the whole world is now witnessing in Wuhan is yet another depopulation event and citizen relocation exercise. Just like the Northern Levant, Israel’s preferred method of waging war is first, genocide, and secondly, forced removal or a coerced exodus.
The same Zionist warmongers will also not hesitate to use any type of terrorism necessary to get the job done. Just look at what they did on 9/11 in order to stampede the whole world into the utterly fake War on Terror. There is perhaps no act of terrorism or violent attack the Neocon Zionists would not carry out in order to advance their devastating Greater Israel project as delineated here: Nothing changes until those who secretly rule US are prosecuted for 9/11, JFK, OK City, 5G, Chemtrails, Vaccines….
Should the unparalleled crisis in the greater Wuhan area continue to deteriorate at the current alarming rate, there’s no telling what the government in Beijing will resort to. Of course, the current government will obey the dictates of their Zionist overlords, even if it means warehousing the citizenry, enforcing vaccinations, pervasive 5G activations, nonstop chemtrailing, etc. Therefore, how this situation develops over the course of the Winter and Spring of 2020 will reveal both the true purpose and perpetrators of this twisted plot.
Wuhan Coronavirus Bioterrorist Attack Is China’s 9/11, Same Perps
The International Criminal Conspiracy
No one can argue that China has been a world leader of the global 5G roll-out. Huawei has aggressively sold their 5G program to every country in the world that will listen… or is not intimidated by Trump’s threat of sanctions should they sign on. In light of this single stark reality, who can argue that China seems clueless to the inherent dangers of 5G … unless they have been paid to be clueless.
The Asians are by their very nature quite vulnerable to the allurements of the latest and greatest IT devices and advancements. This weakness of national character made China the perfect pitchman for 5G worldwide; little do they know that they are working on behalf of the International Banking Cartel.
Not only do the 5G roll-out and IoT build-out represent the most lucrative business opportunities of all time, they promise an IT paradise for any nation that goes for the bait. Far from effectuating an improvement in one’s life, these two major developments are essentially the most important pieces of the quickly materializing Global Control Matrix. Those who opt in to this next generation of the global IT society will not only bask in a field of perilous energies 24/7, they will also be subjected to the highest degree of life-monitoring on the planet today. And, it’s the 5 EYES + ISRAEL who will be running that most invasive spying and surveillance regime ever.
Now, to pull this off successfully, there was a deal made among all the involved state actors and other corporate and institutional co-conspirators. All the usual suspects showed up at the table to include the UN, US, UK, France, Germany, Italy, Australia, Japan, Canada, Israel, Big Tech, Big Social Media, Big Pharma, etc. While that deal was being hammered out, China was working its own deal — on the sly — with Israel—the 5G kingmaker.
What now appears to be the case is that the Chinese government sold its soul to grab all the Eurasian biz. Once that deal with the devil was made, China has gone full-bore with 5G development and deployment via Huawei, Samsung and other corporate titans to lock down the IT marketplace. The real problem with this highly dynamic situation is that no one really knew how much China gave up … until now.
The deteriorating plight of Wuhan is a clear illustration of what can and will happen when any nation signs such a malevolent contract with Israel. Whether the deal unraveled because China balked at the one-sided terms of the contract — after the fact — or whether Israel grossly violated the terms of the contract as they ALWAYS do, remains to be seen.
China Slams Israeli Claim That Coronavirus Came From Bioweapon Lab
Nevertheless, both the United States and United Kingdom were enlisted as always as the contract enforcement muscle. Just as the Brits still control Hong Kong and the Yanks wield much influence inside China through so many corporate spies and Christian missionaries, the Chinese government failed to realize their nation could be turned inside out and upside down with the flip of a switch—a 5G switch by Israel, a coronavirus switch by the US/UK, as well as a Hong Kong protest switch by the UK/US.
5G + Coronavirus + Vaccinations + Chemtrails = Depopulation Event
Let’s face it: it didn’t take a rocket scientist to figure out that the very day 5G was activated in Wuhan along side a recently released virulent flu strain targeting racially susceptible individuals, that people would start dropping like flies. Such an assault on the immune system is guaranteed to take out a big number of city dwellers in a day and a night. And drop on the spot they have done, perhaps many more than the world will ever know.
What has really put the coronavirus outbreak on super-steroids is the ongoing chemtrail operations that put the whole province under a dark noxious cloud. Chemtrails are commonly used to soften up the residents below by introducing various toxic chemicals and pathogenic biologicals into the ambient atmosphere. Once the bioterrain of any individual has been sufficiently cultivated with triggering toxins and pathogenic micro-organisms, the individual is easily preyed on by highly contagious diseases like the Wuhan coronavirus. See: CHEMTRAIL SYNDROME & FLU: A Global Pandemic Of Epic Proportions
Few are aware but Wuhan, in particular, is notorious for its year-long episodes of debilitating industrial pollution. Some of this atmospheric engineering is undertaken with purposeful design via specific chemical releases from industrial smokestacks. Exactly what toxic brews and waste products these discharges are composed of is anyone’s guess. Nonetheless, industrial airborne effluents in China have reached a whole new plateau of pollution that is also affecting nations near and far. See: Is the Wuhan coronavirus a cover story for this, too?
*When toxic chemtrail aerosols are sprayed on the residents below, who are already exposed to a highly infectious coronavirus, while glued to a powerful 5G device after receiving their exceedingly toxic annual flu vaccination, what could possibly go wrong?!
Let’s not forget that the Chinese people have been conditioned (read: socially engineered to get their annual flu shots) to VACCINATE, INOCULATE & IMMUNIZE themselves over many years by the regular serious flu outbreaks which have started in some of the largest metro areas, especially Hong Kong, Shanghai and Guangzhou. With each successive influenza panic, the populace is corralled into the pen of flu vaccine compliance as a means of ‘preventing a mass epidemic’. It is their civic duty, they are told, to vaccinate the whole family so as to not spread the latest flu bug to the rest of the neighborhood or to larger community.
5G is a kill grid that will lead to forced vaccinations! (Video)
Undoubtedly, this Wuhan epidemic was set up for years just waiting for the perfect moment for the Zio-Anglo-American Axis powers to press the button. Now that both the USA and Great Britain have been heavily implicated in this criminal conspiracy, all Israel has to do is avoid having their Mossad fingerprints appearing anywhere near the crime scene. Even if Zionists do somehow get caught, like they did with 9/11, they are the world’s best at shamelessly blaming their victims as they have already done about the origin of the coronavirus.
These Zionist masters of illusion will employ every trick of the trade they can muster, especially powerful psychological ploys such as predictive programming. Otherwise, how, pray tell, did this ever happen nearly 40 years ago: PREDICTION OF THE WUHAN CORONOVIRUS IN 1981
More Predictive Programming About ‘A virus called Wuhan-400’
PSYOP
Undoubtedly, the single most important piece of this captivating psyop is the worldwide initiative to develop a vaccine that will supposedly serve as a prophylactic measure to contracting the coronavirus. Never has there been such a highly coordinated international effort to produce a vaccine in the wake of any previous epidemic or pandemic.
As always, the dangerously untrustworthy World Health Organization (WHO) is leading the global charge to develop a vaccine that is likely impossible to create within the stated time frames. What this really means is that Big Pharma has already secretly manufactured massive amounts of a so-called ‘Wuhan coronavirus vaccine’ (which treats the WHO-named COVID-19) that is ready to be injected worldwide, especially wherever the World Health Organization and Bill Gates have set up their countless vaccination centers in Third World countries. See: Bill Gates Accused Of Starting Ebola Outbreak In African Village By Putin
As always, the poorest and least educated nations will be victimized by this meticulously designed psyop. Something so HUGE as this Western-manufactured coronavirus pandemic provides a unique opportunity for the reptiles at the very top of the food chain to conduct a mass casualty depopulation event the likes of which the world has never seen.
Every person on the planet needs to be aware that this represents only one component of this swiftly manifesting psyop. Surely, this NWO psychological operation will morph and mutate according to the reactions of each national populace on all 7 continents. Then, each [HARDWIRED] locale will be responded to by the authorities in a manner so that sufficient consent is manufactured in order to lock each place down … until the whole place is locked down.
Such draconian measures are already being taken in the rich, industrialized nations such as the United Kingdom. See: Look at how they’re locking down the UK because of the coronavirus!
Given these draconian developments worldwide, particularly with respect to unprecedented police powers being given to law enforcement everywhere, this staged pandemic has all the hallmarks of a classic “Problem~Reaction~Solution” black operation being run by the global intelligence community with the C.I.A., MOSSAD and MI6 taking their usual lead.
There is no more effective way to foist a totalitarian One World Government upon the world community of nations than to scare every inhabitant of planet Earth into demanding it. Of course, coronavirus fearmongering appears to be the path forward for the perps at peak of the world power pyramid, and now that they have started the giant snowball rolling down the hill toward global depop, there may be no stopping it. But, we wait and see how “deus ex machina” might prevail in this Shakespearean tragedy. Perhaps the perps will be found out and taken out.
Donald Trump | Xi Jinping | Vladimir Putin
There’s a very curious connection (and disconnection) between the three most prominent leaders on the world stage today regarding this pandemic which demands further treatment if this important analysis is to withstand legitimate scrutiny.
First, there is President Donald Trump.
It’s quite unlikely that Trump knows anything of substance about the real pandemic plot. He simply could not be trusted by the real perps. However, that does not mean Trump is not being used all day long to send messages and make pronouncements that serve the various Zionist agendas, and there are several. What follows is an illustration of how he is being used as a transparent tool in this way.
CORONAVIRUSgate: The only way Trump could ever make such a ridiculous prediction about April is because he was ordered to by the real perps!
Both Father Trump and Daughter Ivanka have already demonstrated their zeal for all things 5G, and especially how important it is for the U.S. to stay way ahead of the Chinese in this regard. Why it’s so urgent for the US government to fry its citizens before the Chinese government does the same has never been adequately addressed by Trump … or anyone else in his administration.
Contrary to so much false reporting, 5G has NOT been canceled by Trump nor has its harmful effects been eliminated because it’s impossible……5G is currently undergoing a large-scale military deployment nationwide.
The key point here is that Trump has always placed MIGA over MAGA. He has done the bidding of Israel as no other POTUS in American history. Toward that end, Trump has made the 5G roll-out a major priority throughout his term in office because it’s Israel’s top priority. Not only will Israel gain considerably from the 5G and IoT economic boom, it will provide them with financial independence, which they have been desperately seeking for decades, from every country they routinely fleece and swindle. See: Germans swindled yet again
Trump’s main thrust (and complaint to his antagonists) is that he wants the USA to lead the worldwide 5G revolution, not China. He has taken his vicious 5G war against Huawei to Europe and beyond, even threatening every national Huawei customer with economic and/or financial sanctions. Trump has quite recklessly done all of this after coercing Canada to arrest Huawei’s CFO in order to extradite her to the U.S. to face prosecution for violating his illegal sanctions against Iran—WOW! ! !
Here’s Why Canada Arrested Chinese CFO for Trump Admin
Then, there is President Xi Jinping.
If ever there was a prez sitting in a roiling stew pot, Jinping is it. While the Chinese president’s story is way too complicated to understand in any meaningful way in this short assessment, an accurate understanding of his true predicament will reveal the most radioactive back story of all.
What can be said about Jinping is that he seems to be a typical Chinaman who places the advancements of information technology over the good health of the citizenry. Just as Beijing has always put China’s industrial prowess even over the well-being of the residents living in the capital itself, so, too, is the military deployment of 5G more sacred than the safety of the populace. That the air quality in Beijing is consistently rated one of the worst in the entire world stands as a smoggy testament to this fact.
That Jinping has even been put in this extremely challenging predicament by his masters in Israel can indicate different things. But, maybe Jinping had enough of Trump’s intimidation and bullying? Or, did Trump become impatient with Jinping’s justifiable recalcitrance? Did Xi attempt to leave the Zionist reservation, which then predicated the rapid explosion of the Wuhan coronavirus? Or, is Jinping just a powerless figurehead playing his part perfectly in this coronavirus pandemic melodrama?
Clearly, it’s way too early to form firm conclusions about Xi Jinping; but how this tragic drama unfolds will certainly reveal the main plot in Beijing, as well as several Chinese sub-plots. In the meantime, the whole world is held captive by the Wuhan coronavirus pandemic which has all the elements necessary to collapse the Global Economic & Financial System. That, too, may be one of the primary objectives of this diligently staged horror show.
Lastly, there is President Vladimir Putin
Putin has made no bones about the fact that 5G and IoT will be fully integrated within the Russian military to whatever extent necessary to stay ahead of the rest of the world, especially the U.S. military. This stated intention appears to be quite true as Putin knows that existential threats lurk around every corner, and the Russian Motherland has a lot of corners to protect and boundaries to defend.
Putin has not made 5G such a priority for Russian civil society, however. The corporate sector may be developing 5G networks and IoT infrastructure to gain advantage in the global marketplace, but Moscow seems to be relatively uninvolved. The Kremlin is well aware of the deleterious effect of the 5G paradigm and only appears to promote it when absolutely required—as a defensive psyop tool.
Putin has been on the forefront of so many vital issues where it concerns human health and environmental protection that it would only make sense that he would not endanger the Russian people with a nationwide 5G roll-out; besides, it’s impossible to do with any level of integrity in a vast country the size of Russia.
Let’s not forget the Brits.
As always, the US-UK Empire stands together when the West takes on the East. However, the very nature of the so-called special relationship is that London uses Washington, D.C. to do all of its dirty work. The British are always very careful to elude blame, especially for matters of such great import as they did with the creation of the coronavirus. While there were several parties involved in that genocidal enterprise, the prime mover was most definitely “The Crown” as seen by the very name — “Coronavirus” — where corona literally means crown. They did not even try to hide it, did those bloody Brits?! As follows:
CORONAVIRUS was funded and patented by Wellcome Trust (UK, fake sold to GlaxoSmithKline), Bill & Melinda Gates Foundation, DARPA, DEFRA (UK), World Health Organization, European Commission (EU) via THE PINBRIGHT INSTUTUTE (UK)
Bottom Line: The unintended benefit of all this manufactured chaos by the highest level of the World Shadow Government regarding 5G is that it has brought a LOT of awareness — GLOBALLY — to what is now the single greatest threat to humanity and the biosphere. Truly, the exceedingly dangerous military deployment of 5G represents an ongoing event with worldwide apocalyptic consequences. In point of fact, the far-reaching health repercussions and unavoidable environmental ramifications will be so profound and pervasive that this depop event will likely evolve into a full-blown ELE if left unchecked by competent authorities.*
*ELE = Extinction Level Event
Coronavirus Distraction
As always, the NWO cabal looks for ways to distract the entire planetary civilization. Really, is there any better way to do this than with a VERY scary coronavirus pandemic?
Whether this pandemic is being completely staged, or is totally real, or is hoax blended with reality cannot yet be determined with any certainty.
At the end of the day, it may not really matter since the end result will be the same. We the People will be deceived into believing that only global governance can solve this ‘dire matter’. And, that only a One World Government can prevent such plagues and pandemics from ravaging humankind in the future.
In this way, the 5G roll-out will proceed forthwith. Even though the 5G energy platform represents the worst and biggest part of the problem, it’s being slyly covered up by coronavirus hysteria. The Chinese government is even singing the praises of the now accelerated 5G roll-out in Wuhan and other major cities as a means of battling the coronavirus! See: Why is Huawei setting up 5G base stations all over Wuhan to help fight the coronavirus?
Really, is there a more efficacious strategy for the perfidious perps to execute their diabolical plan toward total world domination? What better way to accomplish their ultimate objective of global population lockdown via the dictates of a tyrannical technocracy?
KEY POINT: What this depop event really is thus far is nothing short of attempted genocide. Hence, the $64,000 question is “Cui bono?” There is only one tribe behind all the major genocides since 1900. See: GENOCIDE ALERT: Shooting Down Families & Journalist In Wuhan China!!! (Video)
Deep State’s Kill Switch
There’s no quicker way to collapse the Global Economic & Financial System than to purposely propagate a highly contagious virus with an alarmingly high mortality rate. The daily headlines have already proven that business and commerce — EVERWHERE — is being radically affected by this intensifying pandemic. See: BLACK SWAN EVENT = WUHAN CORONAVIRUS PANDEMIC
Deep State, not only in the United States and United Kingdom, but within every nation aligned with the Zio-Anglo-American Axis, has an overriding need to arrest the numerous national movements which are enjoying unparalleled popular and political success. Hence, there’s no question that what we are seeing is either a threat to pull the “Kill Switch” on the Global Economic & Financial System; or that Deep State is holding this threat over the head of every nationalist leader to include President Donald Trump, Prime Minister Boris Johnson and every other head of state who is fighting globalism.
What’s indisputable is that the Wuhan coronavirus bioweapon has all the necessary elements to effectuate a truly devastating pandemic that can penetrate every sphere of life throughout the entire planetary civilization. Clearly, it was designed this way. Now we wait and see if the Deep State perps will actually pull that “Kill Switch” as a means of carrying out THEIR FINAL SOLUTION: Market Crash, Dollar Collapse & World War 3.
“Staged Coronavirus Pandemic”
How is this pandemic being staged, yet at the same time very real?
Here’s how:
SPECIAL NOTE: The Wuhan bio-attack appears to be
just one in a series of ongoing biological attacks being
conducted throughout mainland China. This Zio-Anglo-
American bioterrorist operation is being stealthily
perpetrated to give the appearance that the national
epidemic started with a single case in Wuhan City, when
it’s still being surreptitiously spread in other Chinese
cities via similar modes of propagation. Because the
vectors of dissemination of this weaponized coronavirus
are mapping worldwide at rapidly expanding rates, there
are quite likely multiple methods of proliferation which
are being cunningly implemented to confuse the medical
investigators as well as to avoid detection.
(Source: A Strong Case for Premeditated Act(s) of
Bioterrorism in Wuhan City, China Carried Out
by Paid Agents of the Zio-Anglo-American Axis)
Conclusion
The preceding narrative is long and complicated, we know. The distillation of this very real multi-decade conspiracy as well as the unending associated scandals is this: that the military deployment of 5G worldwide is the central pillar of the NWO agenda which the globalists will not allow to be put in jeopardy or slowed down by popular protests. Hence, the globalists have conducted the Wuhan coronavirus pandemic scare as a means of misdirecting the medical investigators so that the coronavirus symptoms will instead be blamed for all 5G-induced medical ailments and health conditions. See CRITICAL DATA POINT: Wuhan established as Hubei’s first 5G demonstration zone
The worsening plight of the Chinese people has predictably created the context for yet another racially targeted vaccine to be administered first, to the Wuhan control group, and secondly, to the rest of China, and then, throughout the world-at-large. Not only are the medical authorities closely monitoring those who have submitted themselves to past vaccination schedules, they will soon be experimenting with the new series of coronavirus vaccines that specifically address 2019-nCoV.
The other two pillars of this complex depopulation event are chemical geoengineering and industrial pollution. Not only has Wuhan suffered from a tremendous amount of air pollution due to the extraordinary concentration of industries in the greater metro area, the local population has been subjected to various formulations of chemtrail aerosols, each being sprayed with purposeful design.
While this broad analysis of the Wuhan coronavirus pandemic psyop does not offer the detailed breakdown of the undeniable connections between the various aforementioned assaults on the citizenry, all of which mutually support the outworking of this odious black operation, those vital connections — between 5G, Coronavirus, Vaccines, Chemtrails & Pollution — ought to be obvious by now.
CAVEAT: Look out, folks, wherever and whenever they are rolling out 5G locally, spraying chemtrails regularly, fervently pushing vaccines right after the latest frankenvirus or exotic disease outbreak, and relentlessly fearmongering in the midst of it all.
Clearly, the most significant objectives of the coronavirus outbreak are to cover up the Chinese genocide and ensuing global depop, as well as to hide the pivotal link to 5G. Therefore, it’s imperative that all truth-seekers and patriots read the following exposé; our lives and the welfare of our families and friends greatly depend upon it. Also, circulating the many links in this analysis will serve considerably the enlightenment of the greater community around these life-threatening matters.
The Hidden Link Between the Coronavirus and 5G Testing
Until the next installment in this series on the Wuhan coronavirus pandemic, stay safe, stay sober, stay sane, and be sure to follow the coronavirus recommendations of The Health Coach as follows: Here’s How Everyone Can Avoid Getting The Coronavirus.
State of the Nation
February 13, 2020
Author’s Note
Part I of this Wuhan coronavirus series is a vital prerequisite if one is to properly grasp the many angles on this “elaborately staged, global, false-flag, bioterror operation using real bioweapons aimed at multiple national and racial targets in order to accomplish numerous NWO objectives”. Read: WUHAN CORONAVIRUS PANDEMIC BIOENGINEERED: Who’s behind it, why now and why China? – Part 1?
Editor’s Note
For years this Alt Media platform has studied the correlation between the different influenza symptoms and Hyper-electrosensitivity syndrome—a very real medical ailment that even medical doctors are now diagnosing. Since the 5G roll-outs in the big cities, the flu bug seasons are getting worse and longer. Quite coincidentally, many of the flu symptoms are similar to many of those directly associated with Hyper-electrosensitivity syndrome. Surely this is no accident of fate; rather, these two medical phenomena are mutually feeding each other and contributing to the severity of each disease process both individually and jointly. See: Exposure to 5G millimeter waves leads to ……..“flu-like symptoms”.
Source
[1] Huawei
[2] China
[3] Wuhan
Recommended Reading
Well Whaddya Know! No 5G For Israel!
References
‘The Father of the Coronavirus Virus is the CDC’, Planted in China by the C.I.A.
CORONAVIRUS BIOWEAPON UPDATE: Unique HIV-1 Signatures Confirmed by Team of Indian Scientists
BIOWARFARE: Wuhan Coronavirus is likely another race-targeting bioweapon strategically unleashed throughout China by U.S. military labs
Wuhan Coronavirus, Jeffrey Epstein and Harvard University
Update 1
During times of a deadly global pandemic, The World Health can invoke special powers that can even override national sovereignty. In the interest of maintaining general safety and minimizing fatalities worldwide, the WHO can pull the triggers of various enforcement mechanisms which can effectively lock down the entire planet. National governments can be compelled to take specific actions that which are dictated by the bureaucrats at the United Nations’ specialized agency concerned with world public health. See: WHO pandemic criteria for oppressive governmental actions to be implemented
Update 2
Heres’ more PROOF of British Complicity: The Pirbright Institute is the patent holder of the Coronavirus.
Update 3
Nothing demonstrates more poignantly the purposeful staging of this Wuhan pandemic coronavirus drama than the increasing number of cruise ship melodramas. Are they all real quarantines, or are they elaborately staged hoaxes? Or, are these horror flicks a mixture of both to lend reality. Unfortunately, it’s impossible to know the answers to these important questions. The directors of this worldwide reality show are proven masters of deception; however, that does not mean the perps are not deliberately introducing the coronavirus infection agents into the cruise ship environments. Anything is possible with these criminally insane psychopaths—ABSOLUTELY ANYTHING! Moral of the story (read: drama), don’t go on a cruise … as every single cruise-goer is nothing but a sitting duck … on the wide-open sea! See: No other MSM propaganda outlet hypes like the BBC—Are these coronavirus cruise ship dramas real or reality shows?!
Update 4
Nothing fractures society so deeply as a full-blown pandemic, particularly one that is extremely fatal. The many mainstream media articles, which appeared at the onset of the Wuhan epidemic featuring so many photos of Wuhanese with their masks on, were transparently run that way with purposeful design. No one does deliberate distraction, diversion and misdirection like the CIA’s Mockingbird Media. However, in this case The Company, as the C.I.A. is known within intel circles, is using all the major MSM platforms to further divide We the People, the body politic, the electorate, families, neighborhoods, communities, towns, villages, cities, states, nations and continents across the planet. Without question, this is one of the major aims of this psyop / black op. A disunited world population cannot hold the power elite responsible so much that ails societies everywhere. Just wait … and watch … and see what happens here in the good ole USA during the remainder of 2020. Truly, this country will fracture even more, only this time it will be an “every man for himself” scenario … … … if we let the perps have their nefarious way. If ever there was a time to come together, that time is now. We can all start by praying for the Chinese like there’s no tomorrow.
Update 5
US military prepping for coronavirus pandemic as per The Military Times
Update 6
British Govt Talking Mandatory Vaccinations, Criminalizing Vaccine Criticism (Video)
Update 7
A PhD in Neurotoxicology has recently posted a video under the title: Is the coronavirus pandemic now unstoppable? (Video). Many pandemic investigators medical researchers are wondering if a genie has been let out of the bottle that cannot be put back in.
Update 8
This latest report from the Taiwan News concerns an alarming development whereby the Wuhan Coronavirus Reinfection Is Hastening Fatal Heart Attacks.
Update 9
Why China? Here’s why: Is the coronavirus really a sterilization bioweapon unleashed to reverse the population explosion? Any depop event of this enormity and gravity always has multiple motives. Just as the Spanish flu pandemic — “the deadliest in history that infected an estimated 500 million people worldwide—about one-third of the planet’s population” — was a U.S.-manufactured influenza via vaccines and globalist-directed genocide, so, too, will the Wuhan coronavirus prove to be a similar odious experiment on humanity. If the many bloodlines that converge on the Indian subcontinent suddenly fall prey to the coronavirus, especially an usually mutated form, then the most populous countries are being targeted.
Update 10
As always, all the usual suspects will gain enormously from this bioengineered pandemic. This is how the perps at the pinnacle of the decision-making process rope all the key players into such a serpentine conspiratorial plot. See: CORONAVIRUS BACK STORY: A Massive Criminal Conspiracy Revolving Around Big Pharma
Update 11
The Trump administration has been waging all-out economic war against China with Secretary of the Treasury Steven Mnuchin and Secretary of Commerce Wilbur Ross leading the charge. While Mnuchin has stealthily employed financial terrorism all along, did Ross just unwittingly reveal that economic sabotage was at work via the coronavirus in order to drive American factories back to the U.S.? See: STAGED CORONAVIRUS SCARE: Was this the plan all along to bring manufacturing back to the USA from China? (Video)
Update 12
Now we find out that there were upwards of 10,000 Military Personnel From 110 Nations In Wuhan, China Just Weeks Before the Coronavirus Outbreak. Whenever there are “110 nations” participating in any joint endeavor, it is a patently globalist event, which means this manufactured pandemic is quite likely a MULTINATIONAL BLACK OP! well beyond the proven British, American and Israeli state actors. Not only was the opening ceremony for the 2019 Military World Games held in Wuhan on October 18th, but that was followed by a U.S. men’s soccer match at a Wuhan, China sports venue—ground zero of the virus original outbreak. This international event was probably selected — and specifically timed right at the beginning of China’s annual flu season — because it provided amply opportunity for co-conspirators from around the world community of nations to do the necessary dirty work in case anyone got caught. The US, UK and Israel would then enjoy plausible deniability in the absence of their fingerprints being ‘found’ at the crime scenes. And, yes, there are certainly multiple crime scenes which is why it exploded so quickly.
Update 13
It’s no coincidence that the perpetrators selected the Chinese Year of the Rat to launch this biological attack. Doing so quickly fed the collective imagination (after being intentionally barraged by so many MSM propaganda reports) of how the new plague could have started with bats and snakes and rats, etc.
Update 14
Okay, now here’s a deep dive into the very guts of this extremely sophisticated psyop / black op. The following instructive excerpt goes a long way to revealing how the Alt Media is often used to seed disinfo, misinfo and false info that will then spread like wildfire on the Internet (via social media, of course).
SOTN Editor’s Note: The following transparent disinfo piece ends by stating there are only two possibilities regarding the true origin of the fastidiously bioengineered Wuhan coronavirus which is now ravaging the planet as a pandemic. Really, only 2 scenarios?!
How about the many scientific proofs and other examples of hard evidence which point to “an elaborately staged global, false-flag, bioterror operation using real bioweapons aimed at multiples targets and with numerous NWO objectives”. The following series of 3 exposés clearly delineates this highly organized and rapidly unfolding bioterrorist operation.
WUHAN CORONAVIRUS PANDEMIC BIOENGINEERED: Who’s behind it, why now and why China?
Wuhan Coronavirus Bioterrorist Attack Is China’s 9/11, Same Perps
STAGED CORONAVIRUS PANDEMIC: An International Criminal Conspiracy of Epic Proportions
Now, try to reconcile the ridiculous narrative ‘professionally presented’ below with the preceding three. We’re not saying there are not a bunch of facts conveniently embedded in the following post; although, we do wonder how any author/investigator would gain access to any real facts associated with this tightly controlled, classic C.I.A. black op, which are all well known for being highly compartmentalized operations where all sensitive info/data is only ever provided to the co-conspirators on a strictly need-to-know basis.
Perhaps the dead giveaway of this CIA-directed Mockingbird Media psyop can be found in the header of the originating website. A screenshot of that header shows the very telling blog title: Harvard to the Big House. They don’t even try to hide it anymore… just like the coronavirus was really named after the British Crown which created it (where corona = crown).
(Source: CORONAVIRUSgate: Deep State Disinfo Piece Inadvertently Exposes Collusion Between the Chinese and U.S. Deep States)
Update 15
What follows is yet another glaring example of a globalist shill using a large and powerful Alt Media platform to put out naked NWO propaganda. Advance to the closing minutes of the video to hear Laurie Garrett’s passionate defense of globalism. Also, lots of supposed facts mixed with obvious fiction about the coronavirus are spewed with extraordinary Tavistock-induced confidence.
Here’s an excellent example of how the Alt Media is being used to disseminate disinfo about the coronavirus BY A HARDCORE GLOBALIST! (Video)
Update 16
Here’s yet another example of predictive programming subtly inserted into a popular alt-video production. See: Was the Wuhan coronavirus predicted by the cult classic—I, Pet Goat II? (Video)
Update 17
Hollywood has also produced its fair share of disaster movies some of which may contain predictive programming regarding this particular pandemic. See: CONTAGION: The Ultimate “Divide & Conquer” Bioweapon (Trailer)
Update 18
There may be no quicker way to transition a whole nation to a cashless society than to “quarantine cash and destroy ‘dirty money'” than a highly fatal epidemic. When it becomes a full-blown pandemic, the NWO globalists will push for the entire planetary civilization to go cashless. One of the central pillars of the NWO agenda is a One World [DIGITAL] Currency. This is why TPTB have conducted so many crypto-currency launches (and scams) over the past several years to get folks used to their One World Currency roll-out. See: CASHLESS SOCIETY ALERT: Chinese Banks Are Quarantining Cash, Destroying ‘Dirty’ Money
Update 19
The economic and financial repercussions of this pandemic will be quite profound and pervasive. TPTB certainly had a strong incentive to depop both the Baby Boomers and Beat Generation. Nations around the world are simply not equipped to deal with the unprecedented massive bulge of BB retirees who will need government services and financial assistance of every sort and kind. Most significantly, Social Security and similar government payout programs will soon go broke, just as pension plans are now contracting everywhere some even going bust. The most effective way to stop the payouts is to eliminate the aging recipients. See: Were the elderly around the world targeted with the coronavirus bioweapon? (Infographic)
Update 20
As a geopolitical weapon, it’s now clear that China’s was purposefully incapacitated on the world stage. Not only has Beijing’s extremely ambitious Belt and Road Initiative been thwarted by the coronavirus scare, a number of China’s emerging client states in Asia and Africa have been deeply affected. Even traditional trading partners are forced to take severe precautionary measures while diplomatic relationships are being adversely impacted. Of course, this was all planned out with purposeful design by China’s enemies in order to greatly curtail its expanding influence throughout the world community of nations. Countries such as Iran will no longer be supported as they were by Beijing now that China is totally absorbed with their coronavirus epidemic and national lockdown. See: The HUGE Geopolitical Consequences of the China’s Coronavirus Outbreak
Update 21
Perhaps the greatest economic impact on China is the extent to which so many supply chains have been interrupted. This new state of global affairs will compel many companies to bring all part-manufacturing operations back to their home country thereby hitting China’s GDP in a HUGE way. Truly, this single act of bioterrorism by the Zio-Anglo-American Axis was the game-changer the perps intended it to be. See: CORONAVIRUS: Economic Sabotage Against China by All the Usual Suspects
Update 22
OPERATION CORONAVIRUS PANDEMIC: 16 Reasons for the Deployment of this Devastating Bioweapon in 2020
xxxxxxxxxxxxxxx
March 30-31, 2020 -- No evidence of bio-warfare involved with COVID-19
Israel's cyber-intelligence assets are targeting prospective vaccines and other coronavirus treatments by hacking the emails and databases of top medical research institutes and hospitals, as well as pharmaceutical firms. Israel's computer sleuths have also been working overtime in attempts to interdict the supply chains for ventilators, respirators, and other personal protective equipment (PPE) for redirection to Israeli front companies in foreign countries. Financial intelligence operatives, also working from home, have been tasked to assess the financial health of countries as national treasuries are being stressed to provide payrolls and other social assistance to citizens during the lockdowns being enforced in several nations.
xxxxxxxxxxxxxxx
May 13-14, 2009 -- SPECIAL REPORT. The history of the synthetic H1N1 flu virus and a not-so-rosy future
The history of the extraction of the genetic material from the corpses of victims of the 1918 Spanish influenza virus who were buried in Arctic permafrost is part "X-Files" and part "Jurassic Park." After an unsuccessful 1951 mission, that involved U.S. biological warfare specialists, to extract 1918 Spanish flu genetic material in 1951 from a cemetery in the Inupiat Eskimo village of Brevig Mission, Alaska, scientists made another attempt, a successful one it turns out, in 1997. Dr. Johan Hultin, from the State University of Iowa, successfully extracted genetic material from the corpse of an obese thirty-something female who died from the Spanish flu in 1918, along with 85 percent of Brevig Mission's (called Teller Mission in 1918) villagers in a single week. The pandemic killed at least 50 million people around the world.
Once the Spanish flu genetic material was obtained from the lungs, spleen, liver, and heart of the Eskimo woman's corpse, scientists, in a scene reminiscent of the fictional movie "Jurassic Park," in which genetic material from extinct dinosaurs is used to bring the creatures back to life, recreated the long-since dead 1918 Spanish flu in a U.S.-government funded laboratory. The woman's organs were cut into one-inch cubes and shipped to the Armed Forces Institute of Pathology in Rockville, Maryland where the virus's genetic RNA material was identified and the 1918 Spanish flu was successfully brought back to life.
The search for the frozen bodies of 1918 flu victims was not limited to Alaska. Another team of scientists, acting like Dr. Frankenstein's "Igor," set out to dig up the graves of miners who died from the flu in the remote Norwegian mining village of Longyearbyen in Spitsbergen, which lies north of the Arctic Circle.
WMR has learned from a research scientist who has been working on the recreation of the 1918 flu that the genetic material has been re-engineered to synthetically create what is now known as the A/H1N1 virus, or as the Centers for Disease Control (CDC) calls it, the "novel flu."
The A/H1N1 influenza, which contains genetic material from two strains of swine flu, two strains of human flu, and a single strain of avian flu, has, according to the World Health Organization (WHO), infected a total of 4880 people in North America: 2,059 in Mexico; 2,535 in the United States, and 286 in Canada. There have been 56 reported deaths from the flu in Mexico, three in the United States, and one in Canada.
WMR has learned from an A/H1N1 researcher that the current "novel" flu strain is mutating rapidly in humans but no animals have contracted the virus. The enzyme in A/H1N1, as with all influenza A viruses, is called a polymerase. Scientists have calculated the molecular clock of A/H1N1 form the virus's polymerase rate. Because of the rapid mutation of the virus and the fact that, unlike 1918, rapid global transportation is now the norm, scientists are predicting that the molecular clock of the A/H1N1 virus, coupled with modern transportation, means that almost all the countries of the world will experience an A/H1N1 outbreak within the next few months.
What is different about A/H1N1 is that, unlike other new strains of viruses that rapidly mutate upon emerging and then slow down mutation and then stop entirely, the "novel" or incorrectly-named "swine flu" is showing no signs yet of slowing down its mutation rate and that, according to scientists who worry about A/H1N1 being synthetically-generated, does not happen in nature.
In 2006, at a summit meeting in Cancun, Mexico, President George W. Bush, Canadian Prime Minister Stephen Harper, and Mexican President Vicente Fox agreed for their nations to coordinate their response to avian flu, which was spreading in Asia. National Public Radio, on April 2, 2006, ran a segment on how bird flu wreaked havoc in 1918 in Brevig Mission. NPR's Weekend Edition ran a report from Brevig Mission by Lori Townsend of Alaska Public Radio:
"The grave has been opened twice by the same pathologist. In 1951, Johann Hultin convinced village elders to allow him to take tissue samples from bodies buried in permafrost. His lab attempts to map the virus were unsuccessful, but he returned in 1997, and when he did, he was once again given permission to re-open the grave."
WMR has learned from a journalist from Anchorage who covered the 1997 grave exhumation that there was CIA personnel with the team of scientists. Inuit elders of Brevig Mission argued against digging up the graves of the flu victims would release evil spirits. However, money allegedly changed hands between the U.S. government research team and some of the elders, so permission to dig up the graves was granted.
NPR and Alaska Public Radio was reporting what was extracted from the 1918 flu victim's corpse was the H5N1 avian flu virus, but that was erroneous. Or was it? If what was extracted from the dead woman's body in Brevig Mission was used to synthetically create the current A/H1N1 virus, there is a strain of avian flu in the virus. But the current A/H1N1 virus also contains swine and human flu strains.
What has been relayed by the researcher is that the original 1918 virus was the H1N1 virus. In Bio-safety level 3 (BSL-s) laboratory work that was largely classified, the virus was artifically combined with common H3N2 and a minor gene splice from the H5N1 Eurasian avian flu strain.
The avian flu or H5N1 virus that struck Asia in 2006 contained some genetic mutations of the 1918 virus. And scientists researching pandemic flu strains have, since the recreation of the 1918 flu, been playing fast and loose with flu samples. On April, 17, 2005, The Washington Post reported that Meridian Bioscience, which was under contract to the College of American Pathologists, accidentally distributed the pandemic H2N2/Japan flu strain, as part of a flu testing kit, to influenza laboratories around the world. WHO ordered the labs to immediately destroy the flu sample because it was worried about an accidental release of the pandemic virus, resulting in a global health crisis. In 1957, H2N2 killed a million people around the world.
The Post'sarticle, by Wendy Orent, states that scientists were working to create an artificial strain of the 1918 virus: "[Scientists] can combine some 1918 genes either with laboratory strains that have been adapted to grow in mice, which don't normally catch human flu, or with ordinary human flu strains to yield new artificial strains. Then the researcher infects mice with his new strain. Strains using three of the 1918 genes are already known to kill mice."
The same Postarticle quotes Peter B. Jahrling, the chief scientist at the National Institute of Allergy and Infectious Diseases, about the danger of the virus recreation research. Jahrling stated the research was like "looking for a gas leak with a lighted match." The article continues: "What concerns Jahrling and Brown, among others, is that experiments involving 1918 genes are not being carried out under the highest biosafety level, BSL-4. While most of the scientists use what is known as BSL-3 plus, or enhanced, conditions, they do not use space suits, chemical showers or gas-tight cabinets in their work."
Lastly, the article has a stark warning regarding the 1918 flu reconstruction at the military laboratory in Rockville, research led by Dr. Jeffery Taubenberger. The article states: "Even more disturbing is what may happen when Taubenberger publishes the remaining three gene sequences. Then the entire 1918 flu could be built from scratch by anyone, anywhere, who has sufficient resources and skill. It is quite conceivable that resurrected 1918 flu could someday be used as a bioterrorist agent."
In a January 29, 2006, New York Times article by Jamie Shreeve, titled "Why Revive a Deadly Flu Virus?," it is reported that the 1918 flu had been successfully revived. The article states: "In October, a team of scientists, [CDC's Terrence] Tumpey among them, announced that they had recreated the extinct organism from its genetic code -- essentially the scenario played out in the movie ''Jurassic Park,'' albeit on a microbial scale. In the movie, the scientists' self-serving revivification of dinosaurs leads to mayhem and death . . . . How dangerous is the 1918 virus to today's population? Its genetic code is now in public databases, where other researchers can download it to conduct experiments. Scientists from the University of Wisconsin and the National Microbiology Laboratory in Canada have already collaborated to reconstruct the virus from the publicly available sequence. How easy would it be for a bioterrorist to exploit the same information for malevolent ends?"
The article details how the 1918 genetic material was extracted and who worked on the project: "The resurrection of the 1918 influenzavirus was a team effort engaging the resources of the C.D.C. in Atlanta, an obscure military pathology lab outside Washington, D.C., an esteemed group of influenza experts at Mount Sinai School of Medicine in New York and one elderly Swede. Though the story has been told before, it is impossible not to begin with the Swede. In 1950, Johan Hultin, then a 25-year-old graduate student at the University of Iowa, was searching for a Ph.D. topic when he heard a visiting virologist say that the only way to solve the mystery of the 1918 pandemic would be to recover the virus from a victim who had been buried in permafrost."
There has been yet another secretive U.S. government group involved in researching bio-warfare agents like influenza. Known simply as JASON, the group consists of civilian scientists, the top experts in their fields and a number of Nobel laureates, who meet periodically and issue reports, many of which are classified. JASON has been in existence for 40 years and is thought to be a follow-on to the Manhattan Project, the top secret scientific group that created the atomic bomb during World War II. In fact, some of JASON's earliest members helped to design both the atomic and hydrogen bombs. Its first three members were scientists at Los Alamos National Laboratory, the home of the Manhattan Project.
Operating under the aegis of the MITRE Corporation, a federally-funded contracting entity, JASON scientists primarily met in the highly-secured Building 29 at 3550 General Atomics Court in San Diego. The location is the address of the Torrey Pines Institute. Funded by the Defense Advanced Research Projects Agency (DARPA), JASON also has links, according to distribution lists on JASON reports, to the CIA. The CIA maintains an element called the IC [Intelligence Community] JASON Program under the Chief Technical Officer. Traditionally, JASON self-selects its members from a number of academic disciplines. However, JASON almost lost its funding a few years ago, when, after issuing a report critical of the Bush administration's ballistic missile defense program, DARPA attempted to force three new members, obviously political overseers, on to the JASON membership rolls. DARPA's chief Tony Tether pulled funding for JASON, forcing the group for the first time since its inception in 1959 to look for another Pentagon sponsor. The ballistic missile defense program, also called Star Wars II, was a personal pet project of Secretary of Defense Donald Rumsfeld.
JASON survived when DARPA's parent orgzniation, the Pentagon's Directorate for Defense Research and Engineering (DDR&E), provided JASON with direct funding, an indication of the power enjoyed by the secretive JASON organization. JASON also has other federal government sponsors, including the Department of Energy.
JASON is also very much involved in issues of biological warfare. JASON produced a report on Civilian Biodefense in January 2000, which was highly-redacted when released. Even the names of the report's authors and the information on four bio-warfare scenarios is completely blacked out, except for a discussion of a 1947 smallpox incident in Scenario Two. The report also states that the CIA's Clandestine Measurement and Signatures Intelligence (MASINT) Operations Center and Counter-Proliferation Center were interested in biological weapons intelligence collection and signatures. A section of the report on "Managing Civilian Response" to a bio-war attack is also completely redacted, as is a section on domestic intelligence. A page on the anthrax threat references "psychological BW [biological weapons] warfare." The JASON report was completed almost two years before anthrax attacks all but suspended the work of Congress after 9/11 and saw the quick passage of the US Patriot Act.
The JASON report also discusses the mining of medical data, including patient billing records, to find out if a disease outbreak has occurred and how far and what direction it is spreading by examining "spatiotemporal patterns," including "averaging statistics for humans traveling globally."
In fact, the JASON Civilian Biodefense report mirrors, in many respects, the analysis being currently conducted by medical intelligence (MEDINT) agencies around the world on the outbreak and spread of A/H1N1. And that begs the question: is A/H1N1, artificially-developed by U.S. government scientists, the real thing or a test run for something much worse?
---SIDEBAR:
The Jason report on bio-war discusses "managing civilian response." That also appears be a major concern of the CDC on A/H1N1 at the present time judging from the following internal CDC memo obtained by WMR (note that "swine flu" is being referred to as the "novel H1N1 flu"):
xxxxxxxxxxxxxxxxxxxxxxx
May 8-10, 2009 -- 2008 research meetings on H1N1 flu virus were closed to general public
In yet another example of how research into the current H1N1 hybrid influenza strain has been cloaked in relative secrecy, WMR has learned that two 2008 Asian conferences on both H1N1 (swine flu) and H5N1 (avian or bird) flu were closed to the public and the media. The research presented in Vietnam in October 2008 and Hokkaido, Japan in December 2008 involved the H1N1 and H5N1 "reverse" genetic engineering and gene manipulation that was taking place at the Bio-Safety Level 3 laboratory at the University of Wisconsin-Madison and the Bio-Safety Level 4 laboratory at the National Microbiology Laboratory in Winnipeg.
That research, in part, used viral genetic material extracted from an Inuit woman who died from the worldwide 1918 flu pandemic. The woman's body yielded enough H1N1 genetic viral material that scientists, including some affiliated with the University of Wisconsin-Madison and the Canadian lab in Winnipeg, were able to bring back to life the so-called Spanish flu in a scene right out of the movie "Jurassic Park."
The Winnipeg laboratory figured into a Royal Canadian Mounted Police (RCMP) national security investigation into the November 2001 disappearance of Harvard virologist and influenza expert Dr. Don Wiley. Wiley's body was discovered in the Mississippi River on December 15, 2001 and his death was ruled a suicide from jumping off a bridge into the Mississippi in Memphis.
Except for the animal-to-human transmission vectors, the spreading of avian flu in Indonesia, where there had been no documented cases of the flu in either chickens or humans before it broke out in a "cluster" in 2006, is similar to the way the A-H1N1 (hybrid Mexican flu) was transmitted from human-to-human contact. Both flu strains resulted in fatalities.
H1N1 has reportedly been genetically-manipulated and contains strains of human, swine, and avian flus.
H151 was first reported in Hong Kong in 1997 and in 2003 spread through Southeast Asia, kiling 172 people.
xxxxxxxxxxxxxxxxxxxxxxx
October 22-23, 2014 -- U.S. weaponization of Ebola, other viruses fears
Evidence has surfaced in a U.S. embassy Berlin cable to the U.S. State and Defense Departments that German authorities hesitated to send hemorrhagic fever cultures to the suspected biological warfare laboratory at the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID) in Fort Detrick, Maryland because the Germans feared the Army might "weaponize" the cultures.
The cable, classified as "Sensitive," is dated December 15, 2009 and states:
"German MFA [Ministry of Foreign Affairs] Deputy Head of Division for Export Control Markus Klinger provided the following non-paper to Econoff [Embassy Economics Officer], seeking additional assurances related to a proposed export of extremely dangerous pathogens to the U.S. Army Medical Research Institute for Infectious Diseases. The Army's end use certificate provided to Germany is lacking an official seal. Klinger's deputy, Nancy Reck, noted that Germany had made two follow-up requests to the Army seeking assurances and clarifications related to this proposed export. The GOG [Government of Germany] seeks assurances from the USG [US Government] or US Army that the end use certificate and the information contained therein are legitimate and accurate."
The "non-paper" reference is to an "aide-memoire," what is known in the diplomatic world as a note without an author, source, or title that is used to prepare for negotiations. The following "non-paper," which was originally written in German, was translated by the embassy and sent to Washington:
"For Official Use Only
Against the background of our partnership in the area of non-proliferation and our excellent cooperation in the matters of export controls, we would like to bring the following issue to the attention of your government.
A German firm has applied for the approval of the export of 184 genetic elements with nucleic acid sequences of viruses for the production of recombinant viruses. The viruses will be used in optical imaging to identify host factors required for viral replication. The recipient in the USA is, according to the enclosed end use certificate, the Department of the Army 'US Army Medical Research Institute for Infectious Diseases (USAMRIID)' Fort Detrick, Maryland.
Specifications in English about the goods, the recipient and end use can be seen from the end use certificate. The goods are controlled by the Australia Group and are subject to compulsory export approval (List position C1C353A). This matter concerns the complete genome of viruses such as the Zaire Ebola virus, the Lake Victoria Marburg virus, the Machupo virus and the Lassa virus, which are absolutely among the most dangerous pathogens in the world. The delivery would place the recipient in the position of being able to create replicating recombinant infectious species of these viruses.
Because of the particular criticality of these goods, the German federal government practices an exceptionally restrictive approval policy for such exports. An approval here can only be issued if an improper end use in association with the development or production of biologic weapons approaches can be foreclosed with a probability approaching certainty. The enclosed end use certificate is on the letterhead of the U.S. Army. The required official seal is missing, however. A decision about the export has not yet been made. Given the foregoing, we would appreciate confirmation that the end use certificate really is from the Department of the Army and of the accuracy of the data contained therein. We look forward to the continuation of our excellent cooperation in matters of non-proliferation and export controls."
The German government specifically stated that the ability of Fort Detrick to "create replicating recombinant infectious species" of dangerous hemorrhagic viruses could violate international controls on the export of dangerous weapons of mass destruction that are enforced by the Australia Group of signatories to biological, chemical, and nuclear export treaties.
The Germans are in a position to be well aware of past U.S. involvement in biological warfare operations, especially in Zaire, where, in 1976, the first major outbreak of the Zaire Ebola virus, referenced by the Germans in their aide-memoire, occurred near the Ebola River in northern Zaire (now the Democratic Republic of Congo).
In 1976, while the CIA was experimenting with Ebola and HIV in Zaire as part of its illegal covert war against the Marxist government of Angola, Orbital Transport und Raketen AG (OTRAG), or Orbital Transport and Rockets, Inc., a West German corporation closely linked to West Germany's Bundesnachrichtendienst (BND) intelligence service, established a huge base in Zaire.
NASA and former Nazi rocket scientists Werner von Braun, Kurt Heinrich Debus, and Richard Gompertz, all executives with OTRAG, helped set up a massive 100,000 square miles "rocket base" in Shaba (Katanga) in Zaire. OTRAG's chairman Lutz Thilo Kayer, was associated with the German Nazi rocket and uranium acquisition programs as a young man and later became a technical adviser on NASA's Apollo program. Katanga is also rich in uranium deposits and Kayser's role as an adviser to the West German Research and Technology Ministry may have been a clue to the existence of West Germany's rumored secret nuclear weapons acquisition program.
OTRAG's Zaire base was shut down in 1979 and it was relocated, courtesy of Libyan leader Muammar Qaddafi, to the Libyan desert in 1981. Soviet leader Leonid Brezhnev was so concerned about the OTRAG base's offensive capabilities he pressured French President Valery Giscard d'Estaing to weigh in with Mobutu to force the base's ouster from Zaire.
Katanga was also a longtime base of operations for CIA, West German, Belgian, Rhodesian, South African, Portuguese, French, and British intelligence and mercenary operatives, dating back to the Belgian Congo's transition to independence in 1960.
Every crazy CIA plot you've heard of originated with one man
The CIA's use of Zaire/Congo as a Petri dish for lethal hemorrhagic viruses originated with the above war criminals. German Jewish immigrant and later National Security Adviser and Secretary of State Henry Kissinger [left] and Hungarian Jewish immigrant Dr. Sidney Gottlieb, the CIA's "Dr. Death" [right].
The authorization for the CIA to use the OTRAG zone as a base of operations for the war in Angola came from Secretary of State Henry Kissinger and the operations were carried out by CIA director George Bush, whose father, Prescott Bush, helped finance the Nazi German rocket program during World War II through his work for Brown Brothers Harriman (BBH) and the Union Banking Corporation. The elder Bush's work helped German industrialist Fritz Thyssen obtain critical supplied for the secret German rocket program at Peenemunde on the Baltic Sea.
The agreement between OTRAG and Zaire granted the firm practical complete jurisdiction over the 750,000 Zairian inhabitants of the region and authorized OTRAG to establish airports, telecommunications networks, and factories in the region.
There were suspicions in Zaire and elsewhere at the time that the huge West German rocket base was also being used by the CIA and its Fort Detrick partners to test weaponized Ebola, HIV, and the Reston Ebola-like Marburg virus on suspecting Zairians. After the outbreak of Ebola in the Bumba zone of Zaire, where a number of infected Zairains descended upon the Yambuku Mission Hospital, Zaire's CIA-financed dictator, Mobutu Sese Seko, ordered the Bumba "hot zone" sealed off by his army, which had orders to "shoot to kill" anyone trying to leave the area.
The U.S. Centers for Disease Control's Special Pathogens Branch, now the Viral Special Pathogens Branch (VSPB), along with USAMRIID and the British bio-war facility at Porton Down, England, were all involved in examining cultures from the Ebola outbreak in Zaire. There is little doubt that West German intelligence, which oversaw the operations at the OTRAG base, would have also known the details of the 1976 Ebola outbreak in Zaire, hence, the German government's present concern about Ebola samples sent by them to Fort Detrick being weaponized. The CIA's longtime Technical Services Director, Dr. Sidney Gottlieb, who came up with various ways to infect CIA targets like Congolese Prime Minister Patrice Lumumba, Cuba's Fidel Castro, and Iraqi leader General Abdel Karim Kassem with lethal toxins, admitted to a congressional hearing that as early as 1960 he disposed in the Congo River a large quantity of viruses to contaminate anyone who used the river for drinking water.
Fort Detrick
Suspicions abound that Fort Detrick [left] helped hatch Ebola in Zaire from the West German OTRAG rocket base [right] in Zaire
It is interesting to compare Mobutu's military operations against Ebola victims to that of Barack Obama, who had ordered the dispatch of U.S. troops to Guinea, Liberia, and Sierra Leone to help the governments of those countries militarily seal off the Ebola hot zones. Sierra Leone President Ernest Bai Koroma appears to be taking a page from the playbook of Mobutu. Two Sierra Leoneans were shot dead by Sierra Leone army personnel after health workers in the diamond mining town of Koidu tried to take a blood sample from a 90-year old Sierra Leonean woman. Riots broke out in the town over the attempted drawing of blood. The armed forces of Sierra Leone, Liberia, and Guinea are now being advised on crowd control measures by U.S. Africa Command (AFRICOM) and National Guard civil affairs personnel.
Indonesian Health Minister Siti Fadilah Supari charged that the United States government was developing biological warfare weapons from flu strains found with H5N1 in Indonesia. U.S. Defense Secretary Robert Gates, responding to a question after his address to the Indonesian Council on World Affairs at the Four Seasons Hotel in Jakarta, said of Supari's charge,"I think it's the nuttiest idea I've ever heard." Gates had obviously never heard that the United States attacked Iraq on the "nutty" premise that Saddam Hussein possessed weapons of mass destruction and that Iraq was allied with Al Qaeda.
In a book, Supari charged that the U.S. and the World Health Organization (WHO) were conspiring against developing countries like Indonesia by seizing control of bird flu samples to conduct military bio-weapons research and develop flu vaccines to benefit Western pharamaceutical companies.
Indonesia was not the only country that suspected bio-warfare being behind the avian flu outbreak. On January 10, 2006, a front page report in the Istanbul newspaper Milli Gazete by Mustafa Kurdas and Mustafa Yilmaz saw similarities between SARS and avian flu. The article posed the question whether international players capable of waging biological warfare, such as the United States and Israel, were sending Turkey the "same message through avian flu that they gave to China through SARS."
The 2003 outbreak of severe acute respiratory syndrome (SARS) in China in 2003 wreaked havoc on the Chinese economy. There were suggestions at the time that SARS was also a man-made pathogen designed for biological warfare.
May 8-10, 2009 -- 2008 research meetings on H1N1 flu virus were closed to general public
In yet another example of how research into the current H1N1 hybrid influenza strain has been cloaked in relative secrecy, WMR has learned that two 2008 Asian conferences on both H1N1 (swine flu) and H5N1 (avian or bird) flu were closed to the public and the media. The research presented in Vietnam in October 2008 and Hokkaido, Japan in December 2008 involved the H1N1 and H5N1 "reverse" genetic engineering and gene manipulation that was taking place at the Bio-Safety Level 3 laboratory at the University of Wisconsin-Madison and the Bio-Safety Level 4 laboratory at the National Microbiology Laboratory in Winnipeg.
That research, in part, used viral genetic material extracted from an Inuit woman who died from the worldwide 1918 flu pandemic. The woman's body yielded enough H1N1 genetic viral material that scientists, including some affiliated with the University of Wisconsin-Madison and the Canadian lab in Winnipeg, were able to bring back to life the so-called Spanish flu in a scene right out of the movie "Jurassic Park."
The Winnipeg laboratory figured into a Royal Canadian Mounted Police (RCMP) national security investigation into the November 2001 disappearance of Harvard virologist and influenza expert Dr. Don Wiley. Wiley's body was discovered in the Mississippi River on December 15, 2001 and his death was ruled a suicide from jumping off a bridge into the Mississippi in Memphis.
Except for the animal-to-human transmission vectors, the spreading of avian flu in Indonesia, where there had been no documented cases of the flu in either chickens or humans before it broke out in a "cluster" in 2006, is similar to the way the A-H1N1 (hybrid Mexican flu) was transmitted from human-to-human contact. Both flu strains resulted in fatalities.
H1N1 has reportedly been genetically-manipulated and contains strains of human, swine, and avian flus.
H151 was first reported in Hong Kong in 1997 and in 2003 spread through Southeast Asia, kiling 172 people.
Indonesian Health Minister Siti Fadilah Supari charged that the United States government was developing biological warfare weapons from flu strains found with H5N1 in Indonesia. U.S. Defense Secretary Robert Gates, responding to a question after his address to the Indonesian Council on World Affairs at the Four Seasons Hotel in Jakarta, said of Supari's charge,"I think it's the nuttiest idea I've ever heard." Gates had obviously never heard that the United States attacked Iraq on the "nutty" premise that Saddam Hussein possessed weapons of mass destruction and that Iraq was allied with Al Qaeda.
In a book, Supari charged that the U.S. and the World Health Organization (WHO) were conspiring against developing countries like Indonesia by seizing control of bird flu samples to conduct military bio-weapons research and develop flu vaccines to benefit Western pharamaceutical companies.
Indonesia was not the only country that suspected bio-warfare being behind the avian flu outbreak. On January 10, 2006, a front page report in the Istanbul newspaper Milli Gazete by Mustafa Kurdas and Mustafa Yilmaz saw similarities between SARS and avian flu. The article posed the question whether international players capable of waging biological warfare, such as the United States and Israel, were sending Turkey the "same message through avian flu that they gave to China through SARS."
The 2003 outbreak of severe acute respiratory syndrome (SARS) in China in 2003 wreaked havoc on the Chinese economy. There were suggestions at the time that SARS was also a man-made pathogen designed for biological warfare.
xxxxxxxxxxxxxxxxxx
March 29, 2020 -- Hollywood PolitTrivia: Hollywood alerted to virus pandemic threat time and time, again
Hollywood has long dealt with the subject of global viral pandemics. "Contagion" in 2011, "The Andromeda Strain" and "The Omega Man" in 1971, "The Seventh Seal" in 1957, "Outbreak" in 1995, and "Pandemic" in 2016 are just a few examples in which Hollywood screenwriters took seriously the threat of a global pandemic nearly wiping out the human race.
In 1996, a four-hour NBC television miniseries, titled "Pandora's Clock," involved more than just Hollywood. The miniseries was based on a book by John Nance, a former U.S. Air Force pilot, who served as an aviation consultant for ABC News, primarily on "Good Morning America," and aviation industry consultant. Nance was also a pilot for the defunct Braniff Airlines.
It is clear that given Nance's government connections, "Pandora's Clock" was designed to advance public interest in the global pandemic threat. The plot of the miniseries is a "Doomsday Virus" infecting wildlife documentarian Ernest Helms during a shoot in Bavaria. Helms was played by Michael Winters, who is mostly known for his Shakespearean stage work, but has also appeared as a regular on "Days of Our Lives" and "Ally McBeal." Helms receives a cut on his hand after he has an altercation with a madman trying to break into his car.
Later, while boarding his flight to New York's John F. Kennedy International Airport from Frankfurt, Helms is clearly showing signs of a viral infection. After the plane takes off, Helms has a heart attack and flight attendant Brenda Hopkins, played by Kate Hodge, administers CPR. Hodge is best remembered for starring roles in a series of gory horror pictures, including "Leatherface: The Texas Chainsaw Massacre III." The pilot, James Holland, played by "MacGyver" and "Stargate SG-1" star Richard Dean Anderson, is informed about the medical emergency and he alters course for London's Heathrow Airport. After British air traffic controllers inform Holland that his sick passenger could be infected with a deadly influenza virus, the U.S. President, played by Edward Herrmann, tries to sneak Quantum Airlines Flight 66 into RAF Mildenhall in England. Herrmann, a native of Washington, DC, played Franklin Roosevelt in two memorable TV movies, "Eleanor and Franklin" in 1976 and the following year, in "Eleanor and Franklin: The White House Years." In 1984, Herrmann played the controversial accused Soviet spy Alger Hiss in the PBS docu-drama "Concealed Enemies."
Herrmann bore an uncanny resemblance to actor Fred Gwynn. When Fox, in 1995, decided to make a TV movie sequel based on the two-season running 1960s comedy, "The Munsters," they looked for someone to play the role of Herman Munster. The original Herman Munster, Fred Gwynn, had died in 1993. It was Edward Herrmann, whose last name was similar to the character's first name, who was tapped to play Herman Munster. In 2014, Herrmann lent his voice to FDR in Ken Burns's PBS documentary, "The Roosevelts: An Intimate History."
In "Pandora's Clock," the president orders the Air Force to misidentify the passenger plane as a U.S. fighter aircraft in order to hoodwink the British. The president's plan is opposed by Lee Lancaster, the U.S. ambassador to the Court of St. James, whose role is played by Robert Guillaume. The actors is best remembered for his character in the television series , "Soap" and its spin-ff, "Benson."
The British discover the U.S. president's plot and jam the runway at Mildenhall with emergency vehicles. Holland threatens to land anyway, but he pulls up at the last minute. Flight 66 instead lands at the U.S. Naval Air Station in Keflavik, Iceland. One passenger, distraught over being placed in quarantine and being separated from her child, flees down the airport stairways and is shot to death by U.S. military personnel wearing Mission Oriented Protective Posture (MOPP) gear. Holland takes off and flies to Mauritania, a destination arranged by the Central Intelligence Agency. However, a female CIA agent warns Holland that the CIA, headed up by Jonathan Roth, has set a trap and that the plane will be shot out of the sky by a missile-armed Lear jet. Roth was played by veteran film and TV actor Robert Loggia. Roth's clandestine operations chief is played by Stephen Root, who is most recently remembered for his role as Hawthorne Abendsen in the TV adaptation of Philip K. Dick's "The Man in the High Castle."
Using evasive maneuvers, pilot Holland and his co-pilot Richard Lawson, whose first big picture was "Dirty Harry," causes the Lear jet to crash before it can bring down Flight 66. He then lands on Ascension Island, a remote speck of land in the South Atlantic.
The viral influenza infects the entire planet and scenes from this 1996 movie bear amazing resemblances to our current pandemic. Eerily, "Pandora's Clock" was filmed in Seattle, the first ground zero in the United States for COVID-19. Now, without any further ado, we present, "Pandora's Clock."
xxxxxxxxxxxxxxxxxxxx
Fort Detrick
Milfuegos ...reprinted from WayneMadsenReport
May 15-17, 2009 -- Canada's "Fort Detrick" and lax security threaten deadly pandemics
Canada's version of the United States biological "research" laboratory at Fort Detrick, Maryland, the National Microbiology Center in Winnipeg, Manitoba, is once again in the news for a serious breakdown in security of pathogenic materials.
Konan Michel Yao, a native of Ivory Coast, was arrested by FBI agents on May 5, while trying to transport 22 vials of genetic material from the deadly Ebola virus from the Winnipeg laboratory to what Yao claimed was his new research job at the National Institutes of Health (NIH) in Bethesda, Maryland. NIH is near Washington, DC and is even serviced by a Metro subway station that transports passengers on the "Red Line" into the heart of the nation's capital.
Yao removed the material this past January and hid the vials, containing Ebola and HIV genetic material, in a glove and inside aluminum foil. The Centers for Disease Control (CDC) in Atlanta claim the genetic material is not infectious, however, as previously reported by WMR, similar genetic material extracted from the corpse of an Inuit woman who died of the 1918 "Spanish flu" was extracted in 1997 and used the synthetically create the current A/H1N1 hybrid or "novel" influenza virus. The Winnipeg facility, as well as the University of Wisconsin in Madison, was involved in the H1N1 research and vials of H1N1 and other influenza strains were transported back and forth from Madison to Winnipeg.
On May 6, 2009, WMR reported that in 2007, "macaque monkeys were infected with the 1918 flu virus at the Canadian laboratory by some of the same researchers who were involved in the risky Ebola research in Madison." In addition, the article stated that on September 20, 2007, the Madison laboratory was cited for safety violations. The Madison facility claimed that because Ebola studies were being conducted in a less-secure Biosafety Level 3, instead of a Level 4 laboratory, the Ebola research was shut down. However, it was also reported that the Ebola genetic strains, said to be "DNA copies" of the virus, were then transferred to the Winnipeg facility's Level 4 laboratory. It was the Level 4 laboratory from which Yao reportedly stole the Ebola strains confiscated at the Manitoba-North Dakota border on May 5.
Yao was arrested at the border crossing at Pembina and was heading in a direction that would have taken him through Madison on Interstate 94 to Chicago and onward to Washington, DC. Based on past exchange of dangerous pathogenic materials between Winnipeg and Madison, there is a possibility that Yao could have dropped off some or all of the Ebola vials at the Madison laboratory.
On March 2, 2005, a courier truck crashed in downtown Winnipeg that was transporting anthrax from the Canadian Forces Base in Ralston, Alberta and influenza, salmonella, e.coli, tuberculosis, and HIV from a laboratory in British Columbia.
What is not being explained is where Yao kept the Ebola virus material from January to May and whether he transported any other pathogenic material from the Winnipeg laboratory. As WMR reported on May 6, the day after Yao was arrested, the Winnipeg facility also contains strains of hanta virus, Marburg virus, and Lassa fever. On November 30, 2001, the Memphis Police Department received a phone call from Detective Paul McKemmie of the Royal Canadian Mounted Police National Security Investigation Unit in Ottawa stating that a sicentist at the Winnipeg facility was a likely target for kidnapping by "bio-terrorists." The Memphis police were investigating the disappearance of Dr. Don Wiley, a noted virologist from Harvard University, whose body was later discovered in the Mississippi River in Vidalia, Louisiana.
A number of scientists working on AH1N1 and Ebola have also conducted research at St. Jude's Children's Hospital in Memphis. Wiley served as a member of the St. Jude's science advisory board and was in Memphis for an annual St. Jude's banquet at the time of his disappearance, which was ruled a suicide by the Shelby County medical examiner.
For the first time, WMR is revealing what a special investigation in 2002 of Wiley's death, which now appears to have been a murder, revealed about St. Jude's. While investigating establishments around the Peabody Hotel in Memphis where Wiley may have stopped before he turned up missing, this editor obtained information from a St. Jude's insider that the books were "being cooked" at the charitable children's hospital, which is dedicated to finding cures for cancer. What was reported by the insider was that large sums of money were coming into the hospital from "Middle East" sources and this had raised alarms in the hospital's accounting department because it was not showing up on the official books.
Meanwhile, three public schools in New York City have been closed because of A/H1N1, which has left the assistant principal of one of the schools in critical condition. Margaret Chan, the Director-General of the World Health Organization WHO, has warned against a false sense of security over A/H1N1 and of dire global implications for the pandemic.
xxxxxxxxxxxxxxxx
July 1, 2009 -- Wading through the disinformation about A/H1N1
WMR's sources in the A/H1N1 research community previously concluded three things: the present A/H1N1 flu virus would begin to mutate rapidly rendering an vaccines and drugs developed to combat the present pandemic useless; that in a few months every country on the planet would experience an outbreak of the flu; and there was nothing to support earlier beliefs that the hybrid flu came from pigs or any other animal.
All three predictions have turned out to be rock solid.
There are now reports from Brazil, Thailand, Denmark, Germany, and England that the hybrid flu is mutating and is becoming increasingly resistant to the Tamiflu drug.
In addition, the flu is now spreading throughout Africa and the Indian subcontinent, both having been spared infections at the outset of the start of the pandemic in the Western Hemisphere. Mauritius and Kenya are the latest countries to report hybrid flu outbreaks. The World Health Organization has already declared a Level 6 pandemic alert, the first since 1968. It is anticipated that the flu will shortly spread through central Asia from both China and Europe. Nigeria is bracing for the flu to hit that country in the next few days.
Initial reports from Mexico that the present hybrid flu originated at a Smithfield pig farm in Perote in the state of Vera Cruz, Mexico turned out to be unfounded. Original reports claimed the flu had been transmitted by swarms of flies from manure ponds at the Smithfield facility.
WMR has now learned from virus researchers that the hybrid flu was not transmitted from any animal and that there are no documented cases of the hybrid flu infecting any other species other than humans.
xxxxxxxxxxxxxxxxxxxx
November 10-11, 2014 -- U.S. contemplated viral weapons in 1969
At a hearing on June 9, 1969, the U.S. House of Representatives Subcommittee on Defense Appropriations heard testimony from Pentagon chemical and biological warfare officials calling for the inclusion of funds in the 1970 Defense Appropriations bill for the creation of "a new infective microorganism" that would be invulnerable to human immune systems. Dr. Donald M. MacArthur, the Deputy Director of the Department of Defense's Research and Engineering branch, testified that his efforts to create such a microorganism weapon that could defeat human immune defenses would cost $10 million over a five to ten year period. MacArthur was in charge of 76 Department of Defense laboratories at the time of his testimony.
Some ten years later, the world would be plagued by the Human Immondeficiency Virus (HIV)/Acquired Immune Deficiency Syndrome (AIDS), which plagued Africa, the gay community, heroin addicts, and hemophiliacs. More, recently, Ebola reached epidemic proportions in West Africa, with the virus being called "AIDS on steroids." The first case of Ebola was recorded in Zaire, now the Democratic Republic of Congo, in 1976.
MacArthur stated, on the record:
"Molecular biology is a field that is advancing very rapidly, and eminent biologists believe that within a period of 5 to 10 years it would be possible to produce a synthetic biological agent, an agent that does not naturally exist and for which no natural immunity could have been acquired."
The official also stated, "Within a period of 5 to 10 years it would probably be possible to make a new infective microorganism which could differ in certain important aspects from any known disease-causing organisms. Most important of these is that it might be refractory to the immunological and therapeutic processes upon which we depend to maintain our relative freedom from infectious disease…. A research program to explore the feasibility of this could be completed in approximately 5 years at a total cost of $10 million."
The program to jointly develop a synthetic microorganism weapon by the Department of Defense and the National Academy of Sciences/National Research Council (NAS/NRC)was postponed over the previous two years because of decreasing funding for the chemical and biological weapons program, "growing criticism" of the program, and a reluctance to involve the civilian NAS and NRC in the project.
MacArthur was joined in providing testimony to the subcommittee by Dr. B. Harris, Deputy Assistant Director for Chemical Technology within the Research and Engineering office; Dr. K. C. Emerson, Acting Deputy Assistant Secretary of the Army for Research and Engineering; Brig. Gen. W. S. Stone, Jr., Director of Materiel Requirement for the Army Materiel Command; and Col. J. J. Osick, Chief of the Systems and Requirements Divsion of the Directorate of Chemical, Biological, Radiological and Nuclear Operations of the office of the Army Assistant Chief of Staff for Force Development.
MacArthur's information was in answer to questions posed by Representative Robert Sikes (D-FL). Sikes represented the Florida panhandle where a number of military bases were located, including Pensacola Naval Air Station, Hurlburt Field, and Eglin Air Force Base. Sikes was known as a corrupt king of pork barrel projects and he was reprimanded in 1976 by the House for owning stock in defense companies that benefited from contracts he earmarked for his district.
Was the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID) at Fort Detrick ground zero for the viral weapons of HIV/AIDS, Ebola, and deadly E-Z measles vaccine?
In addition to HIV/AIDS first being detected in Cuban troops returning from Angola, where they were fighting against Central Intelligence Agency-supported guerrillas, and in Zaire and Sudan in 1976, the Edmonston-Zagreb (E-Z) vaccine for measles administered by the World Health Organization in the late 1980s and early 1990s to infants in Guinea, Guinea-Bissau, Senegal, Burkina Faso, Haiti, Vietnam, Mexico, Philippines, Egypt, and Argentina. Infant girls in Africa were given twice the dose as boys and, because their immune systems were suppressed from 6 months to years, many of the female infants died. At the same time, the Centers for Disease Control (CDC) and Kaiser Permanente administered the E-Z vaccine to largely African American and Latino infants in Los Angeles. The parents of the infants in Los Angeles were never told that the measles vaccine was experimental. Dr. David Satcher, the director of the CDC, said, "a mistake was made," adding, "it shocked me." The U.S. military's development of microorganism weapons in the 1970s may have behind Satcher's reaction of shock to such testing programs on unwary individuals in Los Angeles and in Third World countries around the world.
As WMR reported on October 22, a leaked December 15, 2009 cable from the U.S. embassy in Berlin to the U.S. State and Defense Departments revealed that German authorities hesitated to permit the transfer of hemorrhagic fever cultures from a German bio-research firm to the suspected biological warfare laboratory at the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID) in Fort Detrick, Maryland because the Germans feared the Army might "weaponize" the cultures. The German government specifically stated that the ability of Fort Detrick to "create replicating recombinant infectious species" of dangerous hemorrhagic viruses could violate international controls on the export of dangerous weapons of mass destruction that are enforced by the Australia Group of signatories to biological, chemical, and nuclear export treaties.
On October 16, the White House announced that it was cutting off funding to risky government experimentation that studied certain infectious agents by making them more dangerous.
xxxxxxxxxxxxxxxxx
July 3-6, 2008 -- Anthrax attacks -- the US Army attacked its own citizens in a biowar assault
WMR has received follow-up information, first reported by Fox News on March 28, 2008, that the US Army Medical Research Institute for Infectious Diseases (USAMRIID) was the source for the aerosolized anthrax attacks launched against Congress and the news media in late 2001. The attacks were designed to maintain the siege mentality of the American people and ensure quick passage by Congress of the USA PATRIOT Act.
Fox reported in March that "The FBI has narrowed its focus to 'about four' suspects in the 6 1/2-year investigation of the deadly anthrax attacks of 2001, and at least three of those suspects are linked to the Army’s bioweapons research facility at Fort Detrick in Maryland . . . Among the pool of suspects are three scientists — a former deputy commander, a leading anthrax scientist and a microbiologist — linked to the research facility, known as USAMRIID. The FBI has collected writing samples from the three scientists in an effort to match them to the writer of anthrax-laced letters that were mailed to two U.S. senators and at least two news outlets in the fall of 2001, a law enforcement source confirmed."
USAMRIID denied it produced or maintained the type of powdered anthrax sent through the mail, an operation that killed two US postal employees at the Brentwood facility in Washington and sickened scores of others and also killed US postal customers around the country. However, Fox News obtained an email from a USAMRIID employee describing how he was surprised to learn the powdered anthrax was produced at Fort Detrick. The e-mail written by the employee who had been asked to compare the anthrax sent through the mail with that produced at Fort Detrick read in part: "Then he said he had to look at a lot of samples that the FBI had prepared . . . to duplicate the letter material . . . Then the bombshell. He said that the best duplication of the material was the stuff made by [name redacted]. He said that it was almost exactly the same . . . his knees got shaky and he sputtered, 'But I told the General we didn't make spore powder!'"
WMR has now learned from an informed source in Frederick, Maryland, the location of Fort Detrick, that the author of the email was in the highest echelons at USAMRIID. Previously, WMR learned from an official of the National Guard Bureau in Provo, Utah that the aerosolized anthrax used in the attacks was originally produced at the US Army's Dugway Proving Ground in Utah, the location of the government's only aerosolized anthrax production facility in the country, and sent to Fort Detrick for use in the postal system attacks in 2001.
WMR has also learned from a source close to the anthrax case that the recent out-of-court settlement by the Justice Department with one-time US government scientist Steven Hatfill was an attempt by the Justice Department to get out from under the anthrax case and a potentially embarrassing production of documents implicating the govenrment through the discovery process. Hatfill sued the government for being named a "person of interest" in the anthrax case. Under the settlement agreement, Hatfill will receive $2.825 million paid out in a yearly annuity of $150,000. The overall settlement by the government with Hatfill and his lawyers is in excess of $5 million.
Former FBI agent Brad Gannon wrote the following on ABC News' website: "The anthrax investigation, almost from the beginning, was hampered by top-heavy leadership from high ranking, but inexperienced FBI officials, which led to a close-minded focus on just one suspect and amateurish investigative techniques that robbed agents in the field the ability to operate successfully."
Even with the proof that Fort Detrick was the source of the anthrax used in the bio-terrorism attack on Congress, the postal system, and the news media, USAMRIID is expanding its BSL (Biosafety Level) -3 and BSL-4 biocontainment laboratories at Fort Detrick, a move that has the citizens of the city of Frederick and Frederick County up in arms. There is now a move to reject the Army's own Environmental Impact Statement on the safety of the expansion and have the National Academy of Sciences review and approve or reject the safety measures being taken by the Army at Fort Detrick. The National Academy of Sciences already rejected a National Institutes of Health (NIH) risk analysis on a proposed BSL-4 lab at Boston University as “not sound and credible."
The history of Fort Detrick and accidents have nearby residents of the bio-warfare lab nervous. In 2002, USAMRIID scientists revealed that over 24 biological agents, including anthrax and Ebola virus, went missing during the 1990s from the Fort Detrick facility. In April 2002, anthrax spores were released into a USAMRIID office and hallway and a USAMRIID scientist tested positive for exposure to anthrax at the facility. In 2003, vials of anthrax and brucellosis were found buried in landfills at Fort Detrick.
A BSL-4 lab is the most secure but most dangerous. BSL-4 labs contain cultures for deadly diseases for which there are no vaccines and no cures. BSL-3 labs are less secure but contain highly-contagious disease cultures that are species-threatening.
Although the United States is a party to international treaties banning the production of biological weapons, the US government is funding the expansion of BSL-3 and BSL-4 biolabs across the country, from Boston University to the University of Texas in Galveston, the Southwest Foundation for Biomedical Research in San Antonio to Aberdeen Proving Grounds in Maryland, Battelle Memorial Institute in West Jefferson, Ohio to the University of Illinois in Chicago, Oregon Health Sciences University in Portland to the University of Nebraska Medical Center in Omaha, and Lawrence Livermore Labs in California to Los Alamos in New Mexico. All are being funded under the rubric of "bio defenses" and are part of "homeland security" and "national defense" funding by the Bush administration.
xxxxxxxxxxxxxxxxxx
August 1-3, 2008 -- Fort Detrick scientist "commits suicide" as anthrax investigation closes in
Bruce Ivins, a microbiologist at the US Army Medical Research Institute for Infectious Diseases (USAMRIID) at Fort Detrick, Maryland, reportedly committed suicide after ingesting prescription-strength Tylenol and codeine, as the FBI prepared to charge him in the anthrax attacks that took place weeks after the 9/11 attack in 2001.
Ivins was part of the FBI team that investigated the anthrax sent in letters to the Senate's Democratic leadership.
In March of this year, Fox News reported: ""The FBI has narrowed its focus to 'about four' suspects in the 6 1/2-year investigation of the deadly anthrax attacks of 2001, and at least three of those suspects are linked to the Army’s bio-weapons research facility at Fort Detrick in Maryland . . . Among the pool of suspects are three scientists — a former deputy commander, a leading anthrax scientist and a microbiologist — linked to the research facility, known as USAMRIID. The FBI has collected writing samples from the three scientists in an effort to match them to the writer of anthrax-laced letters that were mailed to two U.S. senators and at least two news outlets in the fall of 2001, a law enforcement source confirmed." It is now believed that the microbiologist in question was Ivins. The other suspects have not yet been identified. Although the FBI said the four Fort Detrick personnel were suspects, WMR previously reported that some Fort Detrick personnel were in a whistleblower status concerning knowledge of the perpetrators of the anthrax attacks.
Fox News' March report stated: "Fox News obtained an email from a USAMRIID employee describing how he was surprised to learn the powdered anthrax was produced at Fort Detrick. The e-mail written by the employee who had been asked to compare the anthrax sent through the mail with that produced at Fort Detrick read in part: "Then he said he had to look at a lot of samples that the FBI had prepared . . . to duplicate the letter material . . . Then the bombshell. He said that the best duplication of the material was the stuff made by [name redacted]. He said that it was almost exactly the same . . . his knees got shaky and he sputtered, 'But I told the General we didn't make spore powder!'"
WMR reported on July 3, 2008: "WMR has now learned from an informed source in Frederick, Maryland, the location of Fort Detrick, that the author of the email was in the highest echelons at USAMRIID. Previously, WMR learned from an official of the National Guard Bureau in Provo, Utah that the aerosolized anthrax used in the attacks was originally produced at the US Army's Dugway Proving Ground in Utah, the location of the government's only aerosolized anthrax production facility in the country, and sent to Fort Detrick for use in the postal system attacks in 2001."
On October 5, 2005, WMR reported on the major reason behind the Army's anthrax attacks on American citizens and political leaders: "It should be recalled that Congress originally passed the Patriot Act during an anthrax attack on the offices of the Senate Democratic Majority Leader and the Chairman of the Senate Judiciary Committee. Although the anthrax used in the attack was traced to a strain maintained by the U.S. Army Medical Research Institute for Infectious Diseases (USAMRIID) at Ft. Detrick, Maryland, the perpetrators were never found."
On April 8, 2002, this editor wrote the following for CounterPunch: "Now that the Federal Bureau of Investigation (FBI) has officially put the anthrax investigation on a back burner, it is time for Americans to think the unthinkable: that the FBI has never been keen to identify the perpetrator because that perpetrator may, in fact, be the U.S. Government itself. Evidence is mounting that the source of the anthrax was a top secret U.S. Army laboratory in Maryland and that the perpetrators involve high-level officials in the U.S. military and intelligence infrastructure.
Forget unfounded conspiracy theories. The evidence is overwhelming that the FBI has consistently shied away from pursuing the anthrax investigation, in much the same way it avoided pursuing leads in the USS Cole, East Africa U.S. embassies, and Khobar Towers bombings.
On April 4, ABC News investigative reporter Brian Ross broadcast on ABC World News Tonight that after six months the FBI still had hardly any clues and no suspects in its anthrax investigation. A Soviet defector, the former First Deputy Director of Biopreparat from 1988 to 1992 and anthrax expert, Ken Alibek (formerly Kanatjan Alibekov), now a U.S. government consultant, made the astounding claim that the person who is behind the anthrax attacks may, in fact, been advising the U.S. government. After having passed a lie detector test, Alibek was cleared of any suspicion.
Interestingly, Alibek is President of Hadron Advanced Biosystems. On October 2, 2001, just two days before the first anthrax case was reported in Boca Raton, Florida and a week and a half before the first anthrax was sent through the mail to NBC News in New York, Advanced Biosystems received an $800,000 grant from NIH to focus on very specific defenses against anthrax. Hadron has long been linked with the CIA. The links include charges by many former government officials, including the late former Attorney General Elliot Richardson, that the company's former President, Earl Brian, illegally procured a database system called PROMIS (Prosecutors' Management Information System) from Inslaw, Inc. and used his connections to the CIA and Israeli intelligence to illegally distribute the software to various foreign governments.
Ross reported that U.S. military and intelligence agencies have refused to provide the FBI with a full listing of the secret facilities and employees working on anthrax projects. Because of this stonewalling, crucial evidence has been withheld. Professor Jeanne Guilleman of MIT's Biological Weapons Studies Center told ABC, 'We're talking here about laboratories where, in fact, the material that we know was in the Daschle letter and in the Leahy letter could have been produced. And I think that's what the FBI is still trying to find out.'
The first major media outlet to accuse the FBI of foot dragging was the BBC. On March 14, the BBC's Newsnight program highlighted an interview with Dr. Barbara Rosenberg of the Federation of American Scientists. After claiming the CIA was involved, through government contractors, in secret testing of sending anthrax through the mail, Rosenberg, someone with close ties to the biological warfare community, has been attacked by the White House, FBI, and, not surprisingly, the CIA.
The BBC also interviewed Dr. Timothy Read of the Institute of Genomic Research and a leading expert on the genetic characteristics of anthrax. Read said of the two strains, 'They're definitely related to each other ... closely related to each other.' However, Read would not go so far as to suggest the Florida strain, known as the Ames strain, and that developed at the U.S. Army's top secret Fort Detrick biological warfare laboratory - officially known as the U.S. Army Medical Research Institute of Infectious Diseases -- were one and the same.
William Capers Patrick III was part of the original Fort Detrick anthrax development program, which 'officially' ended in 1972 when President Nixon signed, along with the Soviet Union and United Kingdom, the Biological Weapons Convention. Nixon had actually ordered the Pentagon to stop producing biological weapons in 1969. It now seems likely that the U.S. military and intelligence community failed to follow Nixon's orders and, in fact, have consistently violated a lawful treaty signed by the United States.
Last December, the New York Times claimed Patrick authored a secret paper on the effects of sending anthrax through the mail, a report he denies. However, Patrick told the BBC that he was surprised that as an expert of anthrax (he was a member of the UN biological warfare inspection team in the 1990s), the FBI did not interview him right after the first anthrax attacks.
The BBC reported that Battelle Memorial Institute (a favorite Pentagon and CIA contractor and for whom Alibek served as biological warfare program manager in 1998) conducted a secret biological warfare test in the Nevada desert using genetically-modified anthrax early last September, right before the terrorist attacks. The BBC reported that Patrick's paper on sending anthrax through the mail was also part of the classified contractor work on the deadly bacterial agent.
The Hartford Courant reported last January that 27 sets of biological toxin specimens were reported missing from Fort Detrick after an inventory was conducted in 1992. The paper reported that among the specimens missing was the Ames strain on anthrax. A former Detrick laboratory technician named Eric Oldenberg told The Courant that while at Detrick, he only handled the Ames strain, the same strain sent to the Senate and the media. The Hartford Courant also revealed that other specimens missing included Ebola, hanta virus, simian AIDS, and two labeled 'unknown,' a cover term for classified research on secret biological agents.
Steven Block of Stanford University, an expert on biological warfare, told The Dallas Morning News that, 'The American process for preparing anthrax is secret in its details, but experts know that it produces an extremely pure powder. One gram (a mere 28th of an ounce) contains a trillion spores . . . A trillion spores per gram is basically solid spore . . . It appears from all reports so far that this was a powder made with the so-called optimal U.S. recipe . . . That means they either had to have information from the United States or maybe they were the United States.' (author's emphasis).
Block also told the Dallas paper, 'The FBI, after all these months, has still not arrested anybody . . . It's possible, as has been suggested, that they may be standing back because the person that's involved with it may have secret information that the United States government would not like to have divulged.'"
The "secret information" about the anthrax attacks is now leaking out in a torrent and the perpetrator, as many suspected seven years ago, is the U.S. government. So the question begs to be asked -- if the U.S. government would subject its own citizens to a bio-warfare terrorist attack, could it have also engineered plane hijackings and the demolition of the World Trade Center with the assistance of Saudi, Israeli agents, and private military contractor agents? The record now suggests the answer to that question is a clear and very loud "Yes."
xxxxxxxxxxxxxx
April 20-21, 2009 -- SPECIAL REPORT. Anthrax attack on Congress and media had roots in planned US biowar attack on USSR and Albania
According to documents obtained by WMR, the anthrax attacks on the U.S. Congress and the media in October and November 2001 were directly linked to CIA and Pentagon contractors that were developing biological warfare agents in 1983 that were to be used against the Soviet Union and Albania.
On August 4, 2008, WMR reported on the anthrax investigation: "U.S. intelligence sources have revealed that the FBI has gone slow on the anthrax investigation because of the myriad links to covert programs involving Fort Detrick, the CIA, the Army Dugway Proving Ground in Utah (the home to the only aerosolized dry anthrax laboratory), and contractors SAIC, Battelle, and Hadron Advanced Biosystems (now known as Analex Corporation). Such weapons development would be in contravention of the 1972 Biological Weapons Treaty signed by President Richard Nixon and Soviet leader Leonid Brezhnev but may have been subsequently ignored by the CIA following Nixon's resignation in 1974. Former President George Bush headed the CIA from November 1975 to January 1977."
As it turns out, in 1983, the Reagan administration was not only violating the 1972 Biological Weapons Treaty but was planning to target the Soviet Union with newly-developed biological agents.
The FBI concentrated its anthrax investigation on Fort Detrick and the late badgered scientist Dr. Bruce Ivins. The FBI's motives were to avoid the genesis of the illegal US bio-warfare program, located just across the Potomac in Arlington, Virginia's Rosslyn and Court House neighborhoods.
A January 20, 1983, letter from Cabazon Arms,a "CSC-WSI Joint Venture" established by Cabazon Security Corporation (83-180 Requa Avenue, Suite 9, Indio, California) and Wackenhut Services Inc. (3280 Ponce de Leon Blvd., Coral Gables, Florida), as a joint CIA and Defense Advanced Research Projects Agency (DARPA) weapons research and development firm on the Cabazon Indian reservation in California, from Cabazon Arms President John P. Nichols to Dr. Harry Fair of Tactical Technologies, located at 1400 Wilson Boulevard, Room 1014, Arlington (Rosslyn), Virginia, states: "On February 15, 1983, I will be forwarding to you a unique lost of agents and production techniques related to biological warfare. The Stormont Laboratories, Inc., business plan I mailed you was to prepare you for what we are sending you in this area. Their products could be utilized in small countries bordering Albania or large countries bordering the Soviet Union. You will be amazed at the scope." Just down the street from Tactical Technolgies was 1911 North Fort Myer Drive, the location of the offices of CIA covert operatives Edwin Wilson, Thomas Clines, Ted Shackley, Rafael "Chi Chi" Quintero and the center for the shipment of arms to Iran on the ill-fated SS Poet and other illegal arms shipments. Just up Wilson Boulevard from Tactical Technologies was Battelle Memorial Institute, implicated in the anthrax weaponry development.
Tactical Technologies, involved with Hadron and Cabazon, and a CIA front was headquartered at 1400 Wilson Boulevard in Rosslyn.
A stone's throw from Tactical Technologies was 1911 North Fort Myer Drive, the brown building in the center and the headquarters of CIA fronts involving Ted Shackley, Thomas Clines, Edwin Wilson, and the shipping agent for the ill-fated SS Poet.
In a May 25, 1981, Wackenhut Inter-Office memo, Fair is named as "Dr. Harry D. Fair, Chief, Propulsion Technology, Applied Science Division" of the U.S. Army's Picatinny Arsenal in Dover, New Jersey. The same memo states that the Santa Rosa Indians pledged to the Cabazons that their land could be used for the testing of a "rail gun."
It is unclear what Nichols meant by using biological warfare agents in small countries bordering Albania, then a Chinese ally, and large countries bordering the Soviet Union, which included China. However, the possibility that the CIA and its contractors were contemplating a "false flag" biological attack on Albania from non-aligned Yugoslavia that may have been blamed on Moscow and a "false flag" retaliatory biological attack from China on the Soviet Union cannot be ruled out. A Soviet-Chinese war in the early 1980s would have advanced the proto-neoconservative political agenda of extreme anti-Communists in the Reagan administration like Richard Perle and Paul Wolfowitz, individuals who would later play a key part in the bogus intelligence that saw the George W. Bush administration invade and occupy Iraq.
On September 10, 1981, the Riverside, California Police Department noted a major meeting at the Cabazon Indian Reservation that was attended by Earl Brian, identified as a "Wisconsin businessman and CIA employee."
Brian, who was reportedly involved in working for William Casey and George H. W. Bush to pay off Iranian mullahs to arrange for the Iranians to hold the U.S. hostages until after the 1980 presidential election, a criminal conspiracy known as the "October Surprise," was the CIA's point man on developing biological weapons. Brian headed up two companies involved with bio-war research and development for Langley, Biotech Capital Corporation and Hadron. Brian was also involved in selling pirated copies of Inslaw, Inc.'s Prosecutors Management Information System (PROMIS) to foreign clients to fund bio-war weapons research and development on the Cabazon Indian reservation.
Brian was also the president of Xonics, Inc., a CIA and Pentagon contractor based in Los Angeles that was involved in radar and telecommunications systems. Hadron was originally incorporated in 1964 as Bio-Rad. The assets of the failed Xonics and Bio-Rad were combined to form Hadron, which ultimately became Analex Corporation. Analex North America was sold in 2007 to QinetiQ in a deal that involved The Carlyle Group, in which George H. W. Bush had a financial stake.
The correspondence between Nichols and Fair also mentioned Stormont Laboratories, founded by Dr. Clyde Stormont in Woodland, California. Stormont, a native of Wisconsin, was a noted professor of professor of genetics and serology. Stormont, a speciaist on equine blood typing, died on September 10, 2002.
Cabazon and associated firm principal directors also discussed in 1988 the development of biological warfare weapons, including those involving cancer and immuno-deficiency and specifically a patent involving cytotoxic T-Lymphocytes, with the Japanese. The primary Japanese entity involved in signing the agreement with the Cabazon interlocking entities on September 14, 1988,was Ajinomoto Co., Inc. of 1-5-8 Kyobashi, Chuo-ku, Tokyo and an "internationally-recognied Medical School in Japan" that received a CIA grant laundered through the Cabazon entity and the American side of the agreement included Meridian International Logistics, Inc. (MIL), a reputed CIA front and CIA and Pentagon liaison to Cabazon Arms, with offices at 15270 Sutton Street, Suite 101, Sherman Oaks, California and 1666 San Onofre Drive, Pacific Palisades, California, and the U.S. Embassy in Tokyo. MIL had an arms subsidiary, Meridian Arms Corporation (MAC), which dealt directly with Cabazon Arms and Wackenhut.
An undated U.S. government document, classified as "National Security Information: Unauthorized disclosure subject to criminal sanctions," attached to the January 20, 1983 letter from Cabazon Arms' Nichols to Fair, states in a paragraph titled "Possible Military Applications Utilizing Hybridoma Technology" and a sub-paragraph titled "Biological warfare," that states "the gene-splicing technology provides the ability to produce pathogenic (harmful) agents (i.e., viruses). In fact, biological warfare weaponry of this nature (both production and supply) is limited only by the imagination of the scientist."
In addition, the letter states that the Cabazon reservation was being used to develop a small machine gun that could be fitted with silencers. The letter states that Peter Zokosky, who was the owner of an arms manufacturer called Armtec Manufacturing and whose wife was mayor of Indio, had the British interested in the machine gun project. In addition, South Korean ammunition makers were involved, along with Swedish arms manufacturers. Chile and Guatemala were mentioned as possible locations for the manufacture of the weapon, called the Cabazon Arms CA 9 SMG. Other markets for Cabazon Arms mentioned in a September 1, 1981, Cabazon letter, were Bolivia, Peru, Colombia, Venezuela, and El Salvador. Guatemala and El Salvador are described as the "most sensitive." A March 23, 1982, Cabazon Arms letter also stats that potential markets for the firm's ammunition included Argentina, Taiwan, and Turkey. Cabazon Arms also exported night vision goggles to Guatemala and Jordan.
The mention of Chile and Guatemala is significant. On February 4, 2008, WMR reported: "A stringer for the Financial Times, Anson Ng, who was following a CIA-connected money trail connecting the weapons smugglers to Bank of Credit and Commerce International (BCCI) money tranches, including one that led through the Cabazon Indian Reservation in California, was shot and killed in Guatemala City.
On November 27, 1992, a number of dramatic revelations were made in a debate in the British House of Commons, chief among them that a British journalist [Jonathan Moyle] investigating [Chilean arms manufacturer Carlos] Cardoen, Matrix Churchill, and the weapons smuggling ring was murdered in Chile:
The following comments were made by then-MP Ken Livingstone, [later] Mayor of London: 'I must emphasise that we are still talking about allegations that Mark Thatcher [son of Prime Minister Margaret Thatcher] was trading arms to Iraq and that he was trying to sell South African arms to Saudi Arabia. However, if there is any shred of truth in the charges, are we to believe that MI5 and MI6 did not warn the Prime Minister of the day about the activities in which her son was involved? Surely the director of MI5 or MI6 must have thought that it was important, if any information of that kind came to light, to warn the Prime Minister immediately that her son was engaged in activities that were illegal in British law and contravened United Nations resolutions. Of course, the director of MI5 or MI6 would have done that.
I shall examine the position of Dr. Carlos Cardoen a little more. He is a major and powerful figure in Chile. According to Mr. Ari Ben-Menashe, Dr. Cardoen is a business associate of Mark Thatcher. A British journalist who went to investigate Dr. Cardoen has been murdered. That is a particularly unpleasant twist to the story . . .'"
The Cabazon Arms letter to Fair also stated that Kuwait was interested in "financing the production of the CA 9 SMG."
Hadron eventually morphed into Analex. On April 8, 2002, this editor wrote an article for CounterPunch on the Analex connection to the anthrax attacks in 2001: "On April 4, ABC News investigative reporter Brian Ross broadcast on ABC World News Tonight that after six months the FBI still had hardly any clues and no suspects in its anthrax investigation. A Soviet defector, the former First Deputy Director of Biopreparat from 1988 to 1992 and anthrax expert, Ken Alibek (formerly Kanatjan Alibekov), now a U.S. government consultant, made the astounding claim that the person who is behind the anthrax attacks may, in fact, been advising the U.S. government. After having passed a lie detector test, Alibek was cleared of any suspicion.
Interestingly, Alibek is President of Hadron Advanced Biosystems. On October 2, 2001, just two days before the first anthrax case was reported in Boca Raton, Florida and a week and a half before the first anthrax was sent through the mail to NBC News in New York, Advanced Biosystems received an $800,000 grant from NIH [National Institutes of Health] to focus on very specific defenses against anthrax. Hadron has long been linked with the CIA. The links resulted in charges by many former government officials, including the late former Attorney General Elliot Richardson, that the company's former President, Earl Brian, illegally procured a database system called PROMIS (Prosecutors' Management Information System) from Inslaw, Inc. and used his connections to the CIA and Israeli intelligence to illegally distribute the software to various foreign governments."
Also from the CounterPunch article was the following: "William Capers Patrick III was part of the original Fort Detrick anthrax development program, which "officially" ended in 1972 when President Nixon signed, along with the Soviet Union and United Kingdom, the Biological Weapons Convention. Nixon had actually ordered the Pentagon to stop producing biological weapons in 1969. It now seems likely that the U.S. military and intelligence community failed to follow Nixon's orders and, in fact, have consistently violated a lawful treaty signed by the United States . . .Last December, the New York Timesclaimed Patrick authored a secret paper on the effects of sending anthrax through the mail, a report he denies. However, Patrick told the BBC that he was surprised that as an expert on anthrax (he was a member of the UN biological warfare inspection team in the 1990s), the FBI did not interview him right after the first anthrax attacks. The BBC reported that Battelle Memorial Institute (a favorite Pentagon and CIA contractor and for whom Alibek served as biological warfare program manager in 1998) conducted a secret biological warfare test in the Nevada desert using genetically-modified anthrax early last September, right before the terrorist attacks. The BBC reported that Patrick's paper on sending anthrax through the mail was also part of the classified contractor work on the deadly bacterial agent."
On July 30, 2002, this editor filed the following story with Intelligence Online of Paris: The report shows that there was in the months before the anthrax attacks a significant southern California link to biological warfare:
"On March 8, 2001, police in Irvine, California discovered automatic weapons, explosives, and six plastic cylinders containing chemicals beneath the home of Dr. Larry Ford, who had committed suicide on March 2, three days after his Biofem Pharmaceutical, Inc. business partner, James Patrick Riley, was shot by a masked gunman outside the company's headquarters. An associate of Ford was later convicted of the murder. Ford, a devout Mormon who was rumored to have worked at Fort Detrick and the CIA, established a close relationship with South Africa's top secret bio-warfare program, Project COAST. In 1987, Ford, while a professor of gynecology and obstetrics at UCLA, became friendly with Dr. Niels Knobel, a major player in COAST. Ford became a consultant to the South African biowar program and became acquainted with Dr. Wouter Basson, known as "Dr. Death," the head of South Africa's bio-warfare program.
U.S. government investigators are now looking into a link between Basson, Ford, and possibly others involved with anthrax at Fort Detrick, Dugway Proving Ground in Utah, the Plum Island Animal Disease Center in Long Island, New York; and at South Africa's former biowar center at Fort Klapperkop in Pretoria [now Tshwane]."
Other documentation obtained by WMR shows that Cabazon Indian Security, the joint venture with Wackehut, discussed the purchase of Valleyfield Chemical Products Corporation of Valleyfield, Canada, after its owner, Canadian engineer Gerald Bull, was jailed in the United States for the illegal export of weapons to South Africa. Bull had not only worked for the South Africans but also the CIA, Israel, and was later involved in the building of a "super gun" for Saddam Hussein in Iraq. There is a belief that the 1981 testing that was to take place on the Santa Rosa Indian reservation involved Bull's rail gun or "super gun." Bull was assassinated by the Mossad on March 22, 1990 in Brussels. One of the Mossad assassins was reported recently to have been involved in the "hit" on CIA Patriot missile technology transfer expert U.S. Army Lieutenant Colonel William Bennett, who was bludgeoned to death on March 22, 2009, while walking with his wife on an early Sunday morning in Landsdowne, Virginia. Bennett was specifically investigating the illegal theft of Patriot technology by Israel and its sale to Russia and China.
The May 31, 1981, Wackenhut memo states that "Barry Zuckerman and Charles F. Agar, both Canadian citizens, who are involved with a Canadian firm called Mineral Resources International Ltd., as well as both being involved with Canadian financial institutions . . . are interested in the possibility of acquiring this plant [Valleyfield Chemical]. The memo noted that the Wackenhut-Cabazon joint venture would be the foreign marketing representative for the chemical plant after its purchase and that Mineral Resources International already had a joint venture with the Cabazons to explore for oil and gas on the California reservation. The offices of California's U.S. Senators Alan Cranston and S. I. Hayakawa were involved in the agreement between the Cabazons and Canadians.
Cabazon Arms was also linked to First Intercontinental Development Corporation (FIDCO) of 908 15th Street, Suite 6, Santa Monica, California. FIDCO was reportedly a CIA front headed by George K. Pender, that was in charge of a $3 billion fund to reconstruct Lebanon after the 1982 Israeli invasion of the country. FIDCO had direct connections to Lebanese President Amin Gemayel, the influential Chamoun Christian Maronite political family, the Arab Bank in Amman, and the Reagan White House's Michael McManus, Jr., an Assistant to the President. Another CIA front involved with Cabazon was Intersect Corporation, headed by John Vanderwerker, with offices at 18952 MacArthur Boulevard, Irvine, California. FIDCO and Intersect Corporation, as CIA fronts, regularly transferred millions of dollars to finance the CIA's arms and plane sales businesses. Two banks identified in these transactions are Union Bank of Switzerland (UBS) and Credit Suisse in Zurich and Geneva. One of the Credit Suisse-Geneva account numbers used by the CIA entities between 1981 and 1983 for these transactions was 027465905482-1.
Intersect Corporation also had a Washington presence. The Washington Post Style section ran a story on January 27, 1980, about an "old hen" social party at the Smithsonian. Among those quoted in the article was an attendee at the social event, John Elliott of Fairfax, and who was cited as working for the "Intersect Corporation" which "does security work for the government."
Intersect and a Glenn Shockley, a principal of both FIDCO and Meridian International Logistics, were involved with a Spring 1981 aircraft transaction worth $7,800,000, with Parvis Lavi of Omega Industries of Plainview, Long Island. The date is significant because of the Reagan campaign's 1980 October Surprise involving the supply pre-election and post-election of military supplies to Iran in return for Iran holding U.S. embassy hostages in Iran until after the November presidential election to ensure President Jimmy Carter's defeat by Reagan. In 1998, Lavi was charged with illegally selling F-14 spare engine parts to Iran. Lavi also had offices in Los Angeles and Rotterdam. Lavi's brother, Houshang Lavi, was involved in a Carter administration deal in October 1980 to sell up to $10 million in F-14 spare parts to Iran in exchange for the hostage's release. However, key parts of the CIA were working with the Reagan campaign to ensure that there was no pre-election hostage release that could benefit Carter's re-election campaign. In 1983, a Swiss company, Alcari SA, sued Omega Industries for failure to pay Alcari $1.2 million in a deal to sell Iran military supplied in 1981, the same time that the Cabazon-connected CIA entities were involved in money transfers worth over $7 million that involved Omega Industries.
FIDCO, a Delaware corporation organized in 1974, brought a complaint on October 28, 1981, in the U.S. District Court of Appeals in Washington, DC against Ship's Overseas Services, Inc. (SOS), a firm organized in 1972. The complaint dealt with the 1975 shipment of steel pipe from Spain for an oil company in Libya. SOS contracted pipe from Gulf Consolidated International, Inc. in Houston and turned a profit with the Libyans, from which FIDCO demanded a share. The case appeared to be a normal business dispute, except for the fact that appearing as a pro se intervenor before the court was none other than Michael A. McManus, Jr., the Special Assistant to President Reagan. However, the court ultimately found in favor of SOS.
In 1988, the chairman of the Hosue Judiciary Committee's Criminal Justice Subcommittee conducted an investigation of the Reagan campaign's October Surprise conspiracy with Iran. However, as WMR has previusly reported, Conyers has been staffed with individuals over the years who are connected not only to the CIA and CIA front operations in Washington, DC, but American Israel Public Affairs Committee (AIPAC) operatives. The Conyers investigation of the October Surprise went nowhere.
In addition to journalists Moyle and Ng, there would be one more journalist who would be murdered because of his investigation of the arms smuggling and other illegal activities partly based on the Cabazon Indian reservation. Freelance Washington journalist Danny Casolaro was found with his wrists slashed a dozen times in a bathtub at the Sheraton Hotel in Martinsburg, West Virginia, on August 10, 1991. One of the last sources Casolaro spoke to was an official of the Cabazon Arms operation. As with journalist Gary Webb, who uncovered the CIA's links to the same Nicaraguan contra elements who were also involved with Cabazon, Casolaro's death was ruled a suicide. Before and after their deaths, Casolaro and Webb were subjected to a concerted disinformation and character assassination campaign conducted by certain sectors of the corporate media, which, in turn, took their orders from their CIA masters.
xxxxxxxxxxxx
April 25-26, 2009 -- SPECIAL BULLETIN. New swine flu feared to be weaponized strain
According to two mainstream media journalists, one in Mexico City and the other in Jakarta, who spoke to WMR on background, they are convinced that the current outbreak of a new strain of swine flu in Mexico and some parts of the United States is the result of the introduction of a human-engineered pathogen that could result in a widespread global pandemic, with potentially catastrophic consequences for domestic and international travel and commerce.
The journalists have been told by top officials of the United Nations and the World Health Organization (WHO) about the grave dangers posed by the new and deadly swine flu strain, known as A-H1N1. The flu, never before seen by scientists, has already killed up to 68 people in Mexico and has forced the cancellation of public events, including sports matches and concerts, and the closure of schools, libraries, and museums. Eight cases have been reported in Texas and California and one Texas family is already under a quarantine. Doctors are examining several students at a Queens high school in New York who displayed symptoms similar to those experienced by swine flu patients in Mexico.
Our Mexico City source said a top scientist for the United Nations, who has examined the outbreak of the deadly Ebola virus in Africa, as well as HIV/AIDS victims, concluded that H1N1 possesses certain transmission "vectors" that suggest that new flu strain has been genetically-manufactured as a military biological warfare weapon. The UN expert believes that Ebola, HIV/AIDS, and the current A-H1N1 swine flu virus are biological warfare agents.
Past swine flu outbreaks have been spread from pigs to humans, who then passed the flu on to other humans. However, with A-H1N1, there have been no reported infections of pigs. In fact, according to the Centers for Disease Control and Prevention (CDC), A-H1N1 has gene segments from North American swine, bird and human flu strains and a segment from Eurasian swine flu. Costa Rica, Brazil, and Peru have issued alerts to check all incoming passengers from Mexico at border crossings, airports, and seaports for symptoms of the swine flu.
WHO is convening an emergency session of its top medical experts in Geneva and is set to declare H1N1 a "public health event of international concern." It is reported that WHO will recommend travel restrictions to and from areas where the flu has been reported, including Mexico City and the states of Mexico, Hidalgo, San Luis Potosí and Oaxaca.
Our Jakarta source said WHO officials are afraid that the presence of gene segments from dreaded H5N1 bird flu in the A-H1N1 swine flu strain could mean that the new swine flu strain was engineered to "jump species." WMR has been informed that the CDC and U.S. Army dug up the body of an Inuit woman who died in 1918 in Brevig Mission, Alaska from an outbreak of Spanish flu. The influenza pandemic that year killed up to 100 million people worldwide in an 18-month period. Brevig Mission saw 72 of its 80 residents die within five days, the worst case recorded anywhere in the world. WMR has been told the genetic material recovered by the U.S. government from the corpse of the Inuit woman provided the basis for the development of the H5N1, or bird (avian), flu strain at the U.S. Army Medical Institute of Infectious Diseases (USAMRIID) laboratory at Fort Detrick, Maryland, the point of origin for the Ames strain of anthrax used in the 2001 bio-war attacks against the U.S. Congress and the media.
The fear in Asia is that if the A-H1N1 pandemic spreads to the United States, travel to and from the country will be all but shut down.
The following are the symptoms associated with A-H1N1:
cough
fever
sore throat
shortness of breath
muscle and joint pain
The drugs Tamiflu and Relenza are seen as the most effective against A-H1N1.
xxxxxxxxxxxxxxxxxxx
April 29, 2009 -- Swine flu suspected of being man-made
WMR's sources in Jakarta, the Indonesian capital, report that Indonesian Health Ministry officials believe that the current swine flu outbreak could be man-made. Indonesian Health Minister Siti Fadilah Supari said on April 28 that genetic engineering of the swine flu H1N1 was a possibility. Supari has, in the past, said that Western governments were engineering viruses, such as avian flu that wreaked havoc on Indonesia, to boost profits for pharmaceutical companies.
WMR has also received an internal Centers for Disease Control (CDC) memo that suggests the swine flu outbreak is more serious than what is being said in public announcements from the White House and on down the chain. COTPER is the Coordinating Office for Terrorism Preparedness & Emergency Response for which Acting CDC Richard Besser served as director before being named to his present position. In an April 27, 2009 memo, Besser states the future, as far as swine flu is concerned, "contains some uncertainties."
From: CDC OD Announcements
Sent: Monday, April 27, 2009 10:19 AM
To: CDC All - CDC
Subject: From the Acting Director: Swine Flu Response and You
The swine influenza outbreak is evolving quickly. We have planned and prepared for this situation and CDC is vigorously engaged in the response as are other federal, state, local, and international partners. While the future contains some uncertainties as we work to characterize the magnitude of this event, the one thing I am most certain about is the professionalism and dedication of the CDC/ATSDR workforce.
We will be challenged over the coming days, weeks, and months to apply our knowledge and skills to the ongoing effort to mitigate this health threat. Some of you will be directly involved in this response, while others will be expected to pick up routine duties of those called on to work directly on the emergency, in addition to continuing to do your own vital work.
While CDC’s swine flu response is the agency’s top priority, it does not mean we can abandon the critical work outside this response. I will be working with leaders inside and outside the agency to ensure that we dedicate resources when and where they are needed.
I expect that we will be in a hectic period for a time. So far, we have risen to the task admirably, and I find myself awed by the dedication, professionalism, and tenacity of those around me. But, as I stated Friday, this is a marathon, not a sprint. Let’s pace ourselves, take care of each other, and feel confident in our ability to rise to this occasion.
As you work to protect the wellbeing of others, please know that people here at CDC will be engaged in looking out for your safety & well being. We will be making you aware of how to support your own wellbeing and the wellbeing of your colleagues and family. We also know that as members of the CDC workforce, your relatives, neighbors, and friends will approach you for information. Starting today, become familiar with what CDC is doing and stay up-to-date on CDC health recommendations related to this outbreak. Make it a habit to check the CDC Swine Flu Site daily.
We will regularly update you, including in a live e-all-hands meeting tomorrow at 10:30 a.m. Your questions, ideas, and input are important; you can send them soon at the [REDACTED]. We will be sending OD announcements and posting notices and articles on CDC Connects to keep you informed.
Thank you for your exemplary work on behalf of CDC and our public health mission.
--------
From: CDC OD Announcements
Sent: Friday, April 24, 2009 4:10 PM
To: CDC All - CDC
Subject: Troubling Swine Flu in California, Texas; Emergency Operations Activation
CDC reported two cases in southern California of a new strain of swine flu—swine influenza A (H1N1) virus—Tuesday in an MMWR Dispatch. Since then, three additional cases in California and two in Texas have been identified. Patients suffer from respiratory symptoms and one was briefly hospitalized, but I am glad to report that all have now fully recovered. We are also receiving information from Canada and Mexico in this investigation and are aggressively investigating possible sources of the infection. We are working quickly to confirm the information we have; we will keep you posted with information in C D C Connects.
This situation is concerning since it appears that human-to-human transmission is occuring. Additionally, we don't expect the seasonal influenza vaccine to protect against this virus.
I have activated the Emergency Operations Center (EOC) for this investigation. Staff from across CDC have been aggressively investigating possible sources of the infection and the scope of the outbreak, and are implementing measures to mitigate the infection. However, our staffing requirements will likely continue to increase with this possible "marathon," as the investigation continues. Staff will be required both to fill functional roles within the EOC, be members of the functional teams, and deploy to the field to assist our state and local partners with their investigations.
I want to reiterate the seriousness of this response and implore you and your staff to be prepared to support this activation as called upon. If you or your staff are interested in joining the response effort please contact [email protected]
For more information about becoming a responder visit the Responder Readiness Page.
I expect this activation will continue for a while—this is going to be a marathon, not a sprint. We don't know the scope of this yet, but we want to work aggressively to mitigate the potential impact on the health of people everywhere. I'll keep you informed as the situation progresses.
This investigation is a top priority for our agency right now, and it requires a significant commitment of time and energy from those involved. Meanwhile, of course, the people of America and the world depend on us for our dedication to improving public health in all aspects, and one of the great benefits of this position has been to learn more first-hand about the breadth and scope of the work that we as an agency do in public health. So, although I came to this position from C O T P E R, I want you to know that I tremendously value your ongoing commitment to focus on that work now more than ever. Even if you're not in the EOC, your work is important.
For all CDC and ATSDR employees, I urge you to stay home if you are sick. Please do not come to work if you have symptoms of respiratory illness. This is good practice and common sense in any event. Additionally, if you have joined the pool of staff who are willing to be deployed, please check your credentials to make sure you have clearly stated any allergies that may cause respiratory symptoms.
Thanks to those who are participating in this investigation, those willing to be deployed, and those who work hard to improve public health every day—and that's every one of you.
Richard E. Besser, M.D.
xxxxxxxxxxxxxxxxxxx
June 28, 2006 -- WMR has reported on the explosive information from two Iraqi War Army counter-intelligence veterans that they uncovered materials and documents proving that some of Saddam Hussein's chemical and biological weapons were provided in 1988 by
publication date: Apr 23, 2007
Download Print Send a summary of this page to someone via email.
Previous | Next
June 28, 2006 -- WMR has reported on the explosive information from two Iraqi War Army counter-intelligence veterans that they uncovered materials and documents proving that some of Saddam Hussein's chemical and biological weapons were provided in 1988 by The Carlyle Group, through Spanish and French intermediaries. WMR has learned that pre-cursor and recombinant chemicals used in Iraqi WMDs were provided by a Texas petrochemical company and a chemical/biological toxin firm in which George H. W. Bush held and continues to hold a financial stake.
In April 2003, counter-intelligence personnel with the 223rd Military Intelligence Battalion, California Army National Guard, discovered, with the help of an Iraqi Air Force Chief Warrant Officer, aerial bombs specially configured for delivering chemical and biological weapons. The discovery was made at Al Bakr Air Base, some 60 miles north of Baghdad. In all, 29 crates containing the bombs were discovered.
Dave DeBatto, one of the counter-intelligence agents who discovered the bombs, wrote,
"He [the Iraqi Warrant Officer] pointed to the midsection of the bomb and to what appeared to be a small, thin metal door or covering bolted shut with small metal pins and possibly covering a slot or chamber. Inside, ]the Warrant Officer], explained, was a small parachute. He told us that after the bomb was dropped from the aircraft, the metal covering was blown open and the parachute deployed at about two hundred feet, slowing the descent of the bomb. A chemical agent, which was located in another chamber located at the rear of the bomb, was then dispersed into the air in an aerosol spray and spread over as large an area as the prevailing winds allowed.
[The Warrant Officer] led us around to the rear of the bomb and pointed to the tail assembly. It had a circular piece of metal connected to spokes in a conventional sort of design, but the similarity stopped there. Where ordinarily the rear end of a conventional high explosive bomb would taper into a point, this bomb had apparently had the tail section cut off about six inches from the tip resulting in a flat, circular end. Into that flat end, a small handle was inserted like one on a drawer. [The Warrant Officer] motioned with his hand near the handle and said that this device was twisted in order to open the compartment and then the technician pulled the drawer out and inserted a chemical agent in the slot. When finished, the drawer was reinserted into the bomb and the handle was once again secured."
The Iraqi Warrant Officer was proud that he managed to hide the bombs from UN weapons inspectors over the years since Operation Desert Storm. According to information provided to WMR, Saddam's decision to hide these particular weapons from the UN actually protected the ultimate source of the chemical and biological weapons -- companies directly linked to George H. W. Bush and James Baker.
DeBatto wrote, "I opened the folded off-white paper form and noticed several interesting things right away. The bombs had been purchased in the United States in 1988 from what appeared to be a government contractor called The Carlyle Group. I am almost embarrassed now to say that I had not heard of The Carlyle Group at that time so the name meant nothing to me. The only reason I remember it at all is that I was amazed that the bill was in English and I was stunned to see that a bomb that was used by Iraq in delivering chemical WMD – the only WMD found during the entire Iraq war – was in fact supplied to Saddam Hussein by the United States. Un-blanking believable."
However, there is more to this story, much more.
The Bush/Baker-influenced Carlyle Group profiteered from the Iraq-Iran War in the late 1980s. In the late 1980s and early 90s, illegal U.S. weapons shipments to Iraq became the subject of an intensive investigation by the House Banking Committee Chairman, Rep. Henry Gonzalez of Texas. This is what Sen. Edward Kennedy said of Gonzalez at the award ceremony presenting him with the 1994 President John F. Kennedy Profile in Courage Award, "The achievement of banking reform might have been enough courage for most elected officials — but not Henry Gonzalez. The following year, he launched the "Iraqgate" investigation that exposed the role of the Atlanta branch o£ an Italian bank and the involvement of the U.S. Commodities Credit Corporation and Reagan and Bush Administration officials in the illegal sale of U.S. arms to Iraq leading up to Iraq's invasion of Kuwait and the Gulf War. The Bush Administration first asked — and then pressured - Chairman Gonzalez to drop the investigation, on the ground that national security would be compromised. But Chairman Gonzalez saw through that flimsy pretext, and the rest is history."
From the reports of Gonzalez's Banking Committee and two law suits by Desert Storm veterans suffering from Gulf War Syndrome against two Texas-based companies named as sources of chemical and biological weapons for Iraq in court filings, WMR can report that George H. W. Bush and James Baker were directly involved in providing WMDs to Saddam Hussein using then-private businessman Donald Rumsfeld as an intermediary. U.S. Army counter-intelligence agents report to WMR that they and British WMD clean-up personnel were used as a janitorial team to get rid of evidence linking U.S. firms, including Carlyle, Phillips Petroleum (now Conoco Phillips), and Tanox Biosystems of Houston in providing deadly chemical and biological agents to Iraq in violation of UN sanctions. In addition, another Bush-connected corporation, Bechtel, was investigated by Gonzalez for providing not only chemical and biological production materials to Iraq but pressuring the U.S. Export-Import (EX-IM) Bank to underwrite loans for the construction of an Iraq-Aqaba, Jordan oil pipeline. [Vice President Dick Cheney's hand picked President of the EX-IM Bank, publishing magnate Phillip Merrill, was recently found in the Chesapeake Bay with a shotgun blast to the head and weighed down with an anchor].
On February 24, 1992, Gonzalez made the following remarks on the floor of the House concerning Bechtel, the first Bush administrat
xxxxxxxxxxx
The Iraqi dossier and UN weapons inspector reports support what Sen. Donald Riegle, the Chairman of the Senate Banking Committee, reported on Feb. 9, 1994, and reported in the Senate Banking Committee's "U.S. Chemical and Biological Exports to Iraq and Their Possible Impact on the Health Consequences of the Persian Gulf War" (the "Riegle Report"), "the U.S. government actually licensed the export of deadly microorganisms to Iraq. It was later learned that these microorganisms exported by the United States were identical to those the United Nations inspectors found and recovered from the Iraqi biological warfare program."
On September 11, 1990, PBS's Frontline reported the following, "In the beginning, the Banca Nazionale del Lavoro [BNL] provided credit for Iraqi purchases of U.S. grain and other commodities. Most were federally guaranteed loans under a program designed to help American farmers by promoting commodity exports. But the Iraqis soon began using BNL's money for equipment and technology which could help them develop their military-industrial base. BNL extended a $14 million letter of credit to a Tuscaloosa, Alabama company -- XYZ Options -- so the Iraqis could purchase precision carbide tools [which are used in chemical and biological weapon production]. $53.8 million in credit from BNL went to Lummus Crest in New Jersey to build an ethylene plant. Ethylene has many uses, including the production of chemical warfare agents."
In 1994, Bechtel, Phillips Petroleum and other firms were sued by Gulf War Syndrome sufferers for providing to Saddam's government, ethylene, a primary precursor ingredient for thiodiglycol, a chemical used in the production of mustard gas. Between 1983 and 1985, Phillips Export (a subsidiary of Phillips Petroleum), sold 500 tons of thiodiglycol, to the Iraqi State Enterprise for Pesticide Production, via the Dutch firm, KBS Holland. In addition, five tons of thiodiglycol, were allegedly shipped to Iraq via the Spanish firm, Cades. Cades claims chemical was destroyed prior to its delivery. DeBatto and his team discovered the Carlyle shipments of WMDs were made via a Spanish intermediary. Phillips Export/ConocoPhillips is a defendant in a Texas civil suit brought by 3,500 Gulf War Syndrome sufferers.
In 2000, Phil Beck, a partner with the law firm, Bartlit Beck Herman Palenchar & Scott, served as a member of George W. Bush's three-man Florida election trial team that argued on behalf of Bush before Judge N. Sanders Sauls. Beck was supported by four other Bartlit Beck lawyers, Shawn Fagan, Sean Gallagher and Glen Summers, and associate Joseph Fazioli , a former clerk on the U.S. Court of Appeals for the Sixth Circuit. Not surprisingly, Beck served as counsel for Phillips Petroleum in a case involving a Phillips' ethylene plant in Sweeny, Texas (First Olefins Limited Partnership v. Phillips Petroleum Company) and a polythylene case (DuPont v. Phillips Petroleum). Phillips contributed $100,000 to the Bush-Cheney 2000 Presidential Inauguration Committee. Phillips personnel, along with those from Enron, were rewarded with positions on the Bush-Cheney Department of Energy Transition Team. Bush I's Secretary of State Eagleburger serves on the board of Conoco-Phillips.
The discovery of Carlyle documents with WMD components at Al Bakr by US Army counter-intelligence agents closes the loop on the involvement of Bush I and Baker in supplying Saddam Hussein with his deadliest weapons. Bush and Baker are reportedly shareholders in Houston-based Tanox Biosystems, sued by Gulf War Syndrome sufferers for shipping deadly biological agents to Iraq before Desert Storm. Tanox has also been accused of infecting death row inmates at the Texas State Prison in Huntsville with Mycoplasma fermentans (incognitus), eventually passing the results if the tests to the U.S. Army's Fort Detrick bio-weapons laboratory. Another defendant in the Gulf War veterans' suit is Rhone-Poulenc, headquartered in Shelton, Connecticut, and operator of a chemical plant in Houston. (After merger with Hoetsch, Rhone-Poulenc is now known as Aventis). DeBatto's discovery that the Carlyle shipment of the chem-bio weapons was made through Spanish and French intermediaries is bolstered by the fact that two firms identified by Gulf War plaintiffs, one Spanish -- Cades -- and the other French -- Rhone Poulenc -- are identified as pass through firms for U.S. shipments of nerve and mustard gas agents to Saddam in the 1980s.
There is also an interesting Justice Department memo from U.S. Attorney Robert Barr (later elected to the House of Representatives) that was uncovered by Gonzalez that points to Turkish involvement with Saddam's acquisition of WMDs from the United States. After serving a Bush I's National Security Adviser, Scowcroft became the head of the American-Turkish Council (ATC), an entity that figures prominently in the A Q Khan nuclear proliferation network, the work of Valerie Plame Wilson and her Brewster Jennings & Associates covert team, FBI Turkish and Farsi translator Sibel Edmonds' discoveries while looking over FBI intercepts, and the use of Turkish intermediaries connected to Russian-Israeli Mafia syndicates involved in WMD proliferation. Barr subsequently lost his House seat in a redistricting engineered with the assistance of George W. Bush political "Svengali" Karl Rove.
xxxxxxxxxxxxxxxx
Aug. 8, 2006 -- U.S. Postal Service employees of the Brentwood postal facility (now called the Curseen-Morris Mail Processing and Distribution Center) in Washington, DC, victims of the first biological weapons attack in the United States in 2001, now face
publication date: Apr 23, 2007
Download Print Send a summary of this page to someone via email.
Previous | Next
Aug. 8, 2006 -- U.S. Postal Service employees of the Brentwood postal facility (now called the Curseen-Morris Mail Processing and Distribution Center) in Washington, DC, victims of the first biological weapons attack in the United States in 2001, now face additional attacks -- by the senior management of the U.S. Postal Service, including GOP political hack Postmaster General John Potter. According to Brentwood sources, the jobs of the current Brentwood employees are being threatened by an administration bent on privatizing the US Postal Service. Clerk jobs at Brentwood are being transferred to postal facilities as far away as Richmond and Philadelphia, a hardship for longtime residents of the Washington, DC area. Postal service drivers are finding their jobs being outsourced to contract drivers and maintenance workers are being downsized. Postal service management is also dragging its feet on implementing safety measures at Brentwood designed to prevent a repeat of the deaths resulting from the 2001 anthrax mailings.
Brentwood postal employees are also on the receiving end of "aggressive discipline" for speaking out about the changes that are affecting their employment and personal safety. Meanwhile, this coming November will represent the fifth anniversary of the anthrax attacks and resulting postal employee deaths at Brentwood. Plans for a memorial have received no support from either the Postal Service or the Bush administration. Evidence points to the U.S. Army's illegal biological weapons laboratory at Fort Detrick, Maryland as the source for the anthrax used in the attacks.
Brentwood: First under attack from Fort Detrick anthrax and now from downsizing and outsourcing.
xxxxxxxxxxxxxxxx
Italian police and prosecutors investigating secret neo-Fascist Italian "parallel network" linked to Pentagon covert kidnaping team and Israel.
publication date: Apr 5, 2007 | author/source: Wayne Madsen
Download Print Send a summary of this page to someone via email.
Previous | Next
July 6-7, 2005 -- Rome and Washington, DC -- Italian police and prosecutors investigating secret neo-Fascist Italian "parallel network" linked to Pentagon covert kidnaping team and Israel. Two arrests made, many others probable. Possible "control" links between Bush administration and terrorist groups also probed. Assassinated Deputy SISMI chief Nicola Calipari and kidnaped Imam Abu Omar (a U.S. intelligence asset) were also likely knowledgeable about U.S. control links to terrorist groups. Calipari reportedly discovered links between the former U.S. occupation government of Iyad Allawi and extreme Jihadists in Iraq as a result of Calipari's own hostage negotiations with Iraqi insurgents, mostly members of the ex-Republican Guard. The kidnaped Egyptian ambassador to Iraq, Ihab el-Sherif, who was reported on July 7 by the ANSA Italian news agency to have been killed by his captors, may have also been aware of U.S. links to terrorist groups through his own Iraqi contacts, Italian sources, and interrogations by Egyptian authorities of Imam Abu Omar.
On July 5, RAI News of Italy reported that U.S. and Israeli agents worked inside the Italian Red Brigades when Italian Prime Minister Aldo Moro was kidnaped and murdered by the "leftist" terrorist group in 1978. Giovanni Galloni, former Vice Chairman of the Italian Christian Democratic Party, tells RAI that U.S. and Israeli agents working inside the Red Brigades were complicit in the abduction and assassination of Moro.
Updated information has just come from Italy on this explosive story:
Giovanni Galloni who was the Vice Secretary of the Christian Democratic Party and the Vice President of the Superior Council of the Italian Magistrates (Consiglio Superiore della Magistratura - the highest body of the Italian magistrates) -- and a friend of Aldo Moro, the Italian Prime Minister (rumored to be the next President of Italy) who was kidnaped on March 16, 1978 after having been threatened by the United States during the Nixon and Ford administrations to force him to abandon his policy of opening up to the Communist Party of Enrico Berlinguer and a more independent Italian foreign policy concerning the Middle East and other regions. Moro was killed after 55 days and his body abandoned in the middle of Rome in a position equidistant from the headquarters of the Communist Party and the Christian Democracy.
Asked about the US involvement in the kidnapping of Imam Abu Omar in Milan, Galloni made a statement that, by his own admission, was a new revelation. He, apparently shocked the interviewer. Galloni said that:
1) A few days before his kidnaping by, supposedly and officially, the Red Brigades, Moro told him that he was worried because he knew that the Red Brigades had been infiltrated by both the US and the Israeli intelligence. However, neither were passing any intelligence to the Italians at that point. Moro could not understand why. Galloni also said that during the kidnaping those U.S. and Israeli intelligence did not provide any information concerning the place where Moro was kept (Moro was kept for 55 days before being killed) while when U.S. General Dozier was kidnaped, the prison was identified in 15 days.
2) Journalist Carmine “Mino” Pecorelli, who ran a newsletter – Osservatore Politico – OP -- considered closed to intelligence circles [in particular the head of SID Vito Miceli and the head of anti mafia Carlo Alberto Della Chiesa], wrote few days before the kidnaping that an unprecedented act of terrorism was going to take place in a few days. Someone had used him to leak the information. Pecorelli later was killed on March 20 1979, and Giulio Andreotti (who had earlier revealed earlier the existence of the Gladio network) was accused of having carried out the killing through the Mafia, with whom he was accused to have strong links. Galloni said that, in fact, the elimination of Pecorelli was a “very scientific operation” and was carried because of what Pecorelli revealed before the kidnapping of Moro.
3) The Red Brigades who were arrested and tried in three trials for the crime of kidnaping Moro never revealed where Moro was held. Galloni who was the head of the Italian magistrates said that the three judges in the different Moro trials told him that the accused – even supposedly those who said they would confess to everything – were never convincing.
Final quote of the Galloni interview:
“The Red Brigades today tell us that they have said everything they knew . But this is not true. Probably they did not say something. What is this something?... They too wanted to cover up certain positions, certain realities; this is the question mark that pops up. And this is the question mark that pops up concerning our so-called deviant intelligence agencies (Servizi Deviati). Because the Italian “Servizi Deviati” are not deviant, they are persons who, in good faith, thought that -- given the close alliance that we had with the United States – concerning some delicate issue -- they had to answer to their American colleagues of the CIA than to the Italian government…”
ITALIAN SENATOR CALLS FOR INVESTIGATION OF U.S. AND ISRAELI INVOLVEMENT IN MORO KILLING
Italian Senator Gigi Malabarba has tabled a parliamentary interrogation concerning the revelations of Giovanni Galloni RAI interview about the kidnaping and assassination of Aldo Moro in 1978. Malabarba is the head of the senate caucus of the PRC (Partito Rifondazione Comunista).
From Malabarba's statement: “If the CIA and Mossad had infiltrated the Red Brigades before the kidnaping of Moro and this was known to the Italian 'Servizi Deviati' and to a journalist connected to them -- Mino Pecorelli -- there is complicity of the US and Israel in the murder of the statesman who was ready to open the doors of the government to the communists.
Malabarba also stated: “I have presented a parliamentary interrogation to the Prime Minister [Silvio Berlusconi] so that the USA and Israel make available – from their highest political and intelligence level -- immediate information, because, if this [Galloni’s statement] were confirmed -- the history of our country should be re-written and the persons who were considered discredited such as Antonino Arconte [who reportedly was sent to the Middle East in connection with the Moro’s kidnaping] should be again taken seriously."
“In light of the recent illegal actions of the CIA in our country, such as the kidnaping of the Egyptian Imam Abu Omar, the government must stop its evasion of responsibility and launch all the initiatives that could shed light on events that highlight the condition of Italy as one of limited sovereignty , a country where once the “Servizi Deviati” were able to be active and where, today, [we witness] 'secret agreements' between the US and the Italian governments aimed at undermining the Constitution, the law, and the International treaties."
Moro.jpg (3218 bytes)
Italian blockbuster revelations: Aldo Moro kidnaped and killed with complicity of U.S. and Israeli agents.
xxxxxxxxxxxxxxxxxx
UANI
By Kevin Barrett
The Israel-supported group United Against Nuclear Iran (UANI) is pressuring the big pharmaceutical companies to end their Iran business at the exact moment that Iran is the second hardest-hit country by the coronavirus pandemic after China.
The group United Against Nuclear Iran has paid John Bolton a quarter of a million dollars, which (money) is coming from Israel, which of course gets that money by raiding the United States Treasury to the tune of well, one estimate published in Christian Science Monitor two decades ago was that Israel had already stolen trillions, literally trillions of dollars. That's what it cost the United States. So Americans have allowed Israel to colonize them and raid them and rape and pillage them.
Pro-Trump US group moves to prevent medicine sales to Iran
Pro-Trump US group moves to prevent medicine sales to Iran
The American hawkish group UANI is pressuring pharmaceutical firms to stop selling drugs to Iran amid a massive coronavirus outbreak in the country.
And this UANI group is just one of the many Israel pressure groups running United States foreign policy. It's just an outrage. And now they're trying to amplify the plague of coronavirus in Iran, which one suspects that they themselves may have actually engineered, because otherwise how could an Israeli company claim that they'll have a vaccine against coronavirus in less than two weeks when all scientists say that if there's a novel outbreak like this, it would take at least a year to have a vaccine.
A recent article by former CIA officer Philip Giraldi suggests that probably the US and Israel are working together. They’re the same people who used Stuxnet against Iran, endangering the nuclear facilities not only in Iran, but all over the world because it got loose and nearly created horrible nuclear accidents all over the world. And apparently now they've done the same thing with this coronavirus.
Philip Giraldi’s article is called, Who Made Coronavirus? Was It the U.S., Israel or China Itself?, and he strongly suspects the US and Israel, with China being America's biggest geostrategic antagonist and Iran being Israel's biggest problem.
Coronavirus was produced in a laboratory: Former CIA intel officer
Coronavirus was produced in a laboratory: Former CIA intel officer
A former military intelligence officer of the CIA has said that the “Coronavirus did not occur naturally through mutation but rather was produced in a laboratory, possibly as a biological warfare agent.”
The head of Iran's Civil Defense Organization Brigadier General Gholam Reza Jalali just said the same thing. He said this looks like a biological warfare attack against Iran and China. And a new study coming out of China from Tongji University in Shanghai, entitled Single-cell RNA expression profiling of ACE2, the putative receptor of Wuhan 2019 coronavirus shows that this virus has been engineered to target East Asians, and presumably a version of it has been perhaps released and developed by the Israelis to target Iranians.
So we are seeing biological warfare on a massive scale. The United States is the country that has been waging biological warfare on and off ever since it exterminated Native Americans by giving them smallpox blankets, during the Korean War, the United States dropped literally hundreds of thousands of bombs bearing plague... and other diseases on China and North Korea and covered it up. And the book “This Must Be the Place” gives the details on that.
The United States waged biological warfare against its own Congress in 2001 with the anthrax component of the 9/11 anthrax false flag operation, which terrorized Tom Daschle and Patrick Leahy, the leaders of the movement that blocked the Patriot Act, into giving up and allowing the Patriot Act.
So the United States is run by lunatics, by psychopaths who are entirely capable of launching World War 3 by way of a biological warfare attack on China and Iran, with the Iran component presumably led by Israel. That's the most likely explanation for what we're seeing.
In that context, this move by these Israel lobbies that are presumably behind this biological warfare attack, and this launching of what could become World War 3, are pressuring United States to try to help this plague spread in Iran as much as possible by preventing Iran from getting any of the medicines and medical equipment that would need to fight this virus.
And the United States is pursuing this kind of policy right now. Trump has not allowed medical equipment and supplies to go through to Iran. It's absolutely disgusting. We're seeing more smallpox blankets from the psychopaths in charge and the people of the world need to rise up and overthrow these people as soon as possible.
Kevin Barrett is an American author, journalist and radio host with a Ph.D. in Islamic and Arabic Studies. He recorded this article for Press TV website.
xxxxxxxxxxxxxxxxxxx
Dr. David Kelly
Dr. David Kelly - the biological warfare weapons specialist at the heart of the continuing political crisis for the British government - had links to three other top microbiologists whose deaths have left unanswered questions. The 59-year-old British scientist was involved with ultra secret work at Israel's Institute for Biological Research. Israeli sources claim Kelly met institute scientists several times in London in the past two years. Israel has not signed the Biological Weapons and Toxins Convention, an international treaty ratified by more than 140 countries. It forbids the development, possession and use of offensive biological and chemical weapons. The CIA, FBI and MI5 are now examining Kelly's connections. Their findings could form part of the British government's inquiry into the background of Kelly's death, which opened last week. The intelligence investigation is believed to have originated in Washington, where it emerged that Kelly had contacts with two companies in the U.S. bio-defense industry. One of the men he was in touch with was a former Russian defector, Kamovtjan Alibekov. When he arrived in America, he changed his name to Ken Alibek. He is now president of Hadron Advanced Biosystems - a company specializing in medicines against biological terrorist attacks. Kelly was himself considering resigning from his senior post at the Ministry of Defense to work in America. Before his death, he had been discreetly headhunted by two companies. One was Hadron Advanced Biosystems, which has close ties to the Pentagon. Hadron describes itself as "a company specializing in the development of technical solutions for the U.S. intelligence community." Hadron also has links to William Patrick, who has five classified patents on the process of developing weaponized anthrax. He is a biowarfare consultant to both the Pentagon and the CIA. The other company is Regma Biotechnologies - one that Kelly helped its founder, Vladimir Pasechnik, to set up in Britain, arranging for it to have a laboratory at Porton Down, the country's chem-bio warfare defense establishment. Regma currently has a contract with the U.S. Navy for "the diagnostic and therapeutic treatment of anthrax." Kelly had told family friends he wanted to go to America so that he could obtain the specialized treatment his wife, Janice, requires. "He also felt that working in the U.S. private sector would relieve him of the intense pressures which came with his government work," said a colleague in the Ministry of Defense. The two American scientists he had worked with were Benito Que, 52, and Don Wiley, 57. Both microbiologists had been engaged in DNA sequencing that could provide "a genetic marker based on genetic profiling." The research could play an important role in developing weaponized pathogens to hit selected groups of humans - identifying them by race. Two years ago, both men were found dead, in circumstances never fully explained.
xxxxxxxxxxxxx
Jews wall street
In less than a week the Federal Reserve has been merged with the U.S. Treasury (implying it wasn’t always that way) and BlackRock, the world’s largest and most powerful financial services institution, has been put in charge of executing future acquisitions and trades.
Who is BlackRock? What do they own? And perhaps more importantly, what and who do they control? Jazz and James dive into BlackRock and uncover a significant portion of the apparatus by which U.S. politics are controlled and manipulated.
Full episode: TheRightStuff
Transcript follows below.
(Backup audio in case YouTube decides this is something Americans shouldn't know about.)
y2mate.com_-_how_blackrock_leveraged_control_of_the_u.s._economy_qt4ekclqeei.mp3
About the FTN and TRS podcasts:
FTN and the other podcasts on the TRS podcast platform have become required listening for anyone serious about understanding American politics. In a highly professional and competent manner, they analyze topics, including Jewish influence, that others won't.
The FTN podcast in particular is hard news focused, delivering fresh dissident angles on current events that ruthlessly challenge the mainstream narrative.
Some of their episodes are free to the public, while others are behind a $10 monthly paywall, probably the best value in American journalism today because you get access to several excellent shows for that price. We highly recommend Eric Striker's, (editor of the excellent National Justice website), and Mike Enoch's 'Strike and Mike' (1X per week) which are also more hard news focused. The Daily Shoah with Mike Enoch, Jesse Dunstan, and Alex McNabb, (3X per week), which is a less formal, Joe Rogan style radio talk show, is also excellent.
Transcript: the following is machine transcribed. There may be some errors.
[00:00:08] This nationalizing a large swath of the financial markets. Now we've talked about the financialization of the country that started really in the 1970s. With things occurring before the 1970s. But the actual financialization of the economy in 1970s really took off under Ronald Reagan. We did the Reaganomics demographic deep dive. Sorry, Reaganomics, demographic, death spiral, deep dive that we did over Labor Day in twenty nineteen. Very good podcast that we did on that detailing that it was took off under Reagan, took off in two fold under Clinton and has continued and they have used these various recessions.
[00:00:55] The last one was the 2008 financial crisis and this is the latest one actually they had the longest run, longest bull market run in a long time and it's only a matter of time the economy had to be reset and that's what they're doing with this right now. We've talked a lot about this being a restructuring, but this is formalizing this in a way that has never been done before. Now, the big headline that people are getting hung up on is the merger of the Federal Reserve and the Treasury into one organization, implying that they were separate independent organizations at any point ever.
[00:01:28] That's not actually the real story. We'll talk about what they're actually doing, because what they are doing is they're sort of just admitting that it's not it's not that anymore. Like before they would at least put up the pretense that they are separate organizations and they're independent and yadda, yadda, yadda. Now they're sort of dispensing with all of that. But the bigger news is that BlackRock's involvement. So let me walk through this here. So the you this this fits in with our narrative. Lots of confirmation bias. In the past few weeks, you've seen the Federal Reserve cutting rates by 150 basis points to near zero. And they have run through virtually the entire handbook for the 2008 crisis. They've done one rate cut after another, followed by an emergency rate cut. They added a million sorry, they added a trillion dollars a day in repo injections. They used emergency powers to create this commercial paper facility for pumping overnight liquidity into the market, literally making the money printer.
[00:02:31] Rigoberta?
[00:02:32] Yeah, it is. That's exactly what it is. It's literally a facility for Birx restart quantitative easing. Then they changed it to unlimited quantitative easing, which is just fancy speak for Birx agreed to purchase unlimited bonds for the first time ever agree to loan directly to corporations, which is something they've never done before then. Originally the stimulus was supposed to be a trillion. Then it became two trillion. Then it became six trillion. And so they've also added six hundred twenty five billion dollars worth of bond buying a week going forward.
[00:03:06] So if this continues implying that the Fed and the Treasury are two separate entities, the Fed is going to own two thirds of all of the T-bills in the market in less than a year. So it's I mean, this merger of the two is becoming formalized. They've brought back a lot of these acronyms that they had in the 2008 crisis, which were on a much smaller scale. And at that time, you had Bush 43 and Obama had handed over a lot of the control of these programs to Ben Bernanke. But this is all being run by Steve Manoogian now, who is the treasury secretary. And so you have the commercial paper funding facility, CPF F, which is going to be buying commercial paper from the issuer. You have the PMI, CCF, which is the primary market corporate credit facility, which is buying corporate bonds from the issuer.
[00:04:00] You have τα, which is the term Asset Backed Securities Loan Facility, which is a funding backstop for asset backed securities. You have S M CCF, the secondary market corporate kett Creek. You've got to have a backup, right? You have the primary market, a corporate credit facility, and then you have a secondary market, corporate credit facility.
[00:04:20] So they're gonna be buying corporate bonds and bond ETF in a secondary market. And then you have the M SB LP, Ms. Lope Main Street Business Lending Program, details to come. We don't have a lot of details about how Main Street is going to be helped out on this. But these are all organizations that were stood up back then. And so they learned a lot from then and they have realized that they need all of these sort of formalized in a way that can be controlled directly by the Treasury. Right.
[00:04:51] They don't have to pretend that the Fed is operating independently and loaning money to Detroit. I mean, it just doesn't it's the whole thing is just like. All right. Let's just drop this whole charade that we've been doing. Right. I mean, this is and as we pointed out, that. Emptied all of these things when I read through the list of all the rate cuts in repo injections and quantitative easing. Line kept going down line. Loved the six trillion dollar stimulus until Frady and then the line headed for the hills again, nine hundred point drop. So I don't know what it's going to be doing next week. It's going to be very volatile.
[00:05:28] But they're trying to stand all this up to keep things moving along, aren't they? James?
[00:05:34] Yeah, that's I mean, that's the plan. And actually things you can make an argument. They're going to be even worse. I would make an argument. We would make the argument. Things are going to be worse and more complex than they were 10 years ago back in 0 8 because of these new financial innovations and novel investment vehicles that have come online. Right. When you have the VA health. If B as this backstop for the asset backed securities and PMC ISEF buying these corporate bonds. Well, there have been new innovations in these markets since 0 8 where not only now we have the Fed back in back in 0 8, No. 9, they were buying up the mortgage backed securities.
[00:06:11] Right. And taking control of those. But that premise has been exported to other sectors, other security sectors. So you have now a student loan backed securities like we've talked about car loan, bundled securities like we've talked about, all of them organized a Sub-Prime prime, one star or three star. All of these ratings and the Fed is committed now to buying these buying these up with Treasury at this point as committed to buying these up. So you're going to have much more activity in these facilities, much more much more repurchasing going on than you had in 0 8. And that is just going to have cyclical downstream effects.
[00:06:49] It will. And it just the whole so it's this is buying time for the system. This is you know, obviously they had to do this in order to sustain it for what they hope is going to be another decade or two.
[00:07:02] They're trying to put this in place where they think it can go on forever. But what they're finding out is that it creates imbalance. Right. Like the 2008 crisis led to a lot of issues in the economy, but not it, not just in the economy, in the political world as well. It it it actually pushed people on both ends of the spectrum away from the kosher center. Right. You get people that are more interested in a Donald Trump than a Jeb Bush. You get people more interested in a Bernie Sanders than in a Joe Biden. And if they can steal the election, they will. But they didn't count on Donald Trump. And so, you know, now that he's been fully brought to heel, he's going to give Schlomo whatever the fuck line he wants.
[00:07:44] And that is if Trump wants that, too. Right. I mean, he's been he's been, you know, demanding that the central bankers use their power to force line at least 10000 points higher. I mean, he's so angry about no Dow 30000. And it's unlikely, especially if he doesn't win re-election, that he'll ever see Dow thirty thousand. And, you know, just imagine if he'd been able to convince them to do that. How much further this whole thing would have fallen because it's all froth. None of it's real. So the Fed essentially a.k.a. Treasury, one big organization, money printing Gober, they're going to finance these special purpose vehicles for each acronym that I mentioned above to conduct these operations.
[00:08:30] And so the Treasury is going to use these and become a each each SPV will be in a first loss position. So this means that the Treasury, formerly not implying formally, is going to be buying all the securities and backstopping loans and the Fed is going to be acting as the banker providing the financing. But really, it's just one entity. They're doing both. But the new the new kid on the block is BlackRock and BlackRock. We're going to talk a lot about BlackRock here in a minute. But they have agreed to purchase these securities and handle the administration of the S.P. v.'s on behalf of the Treasury.
[00:09:11] So this is this like totally not a government agency, right? The Fed and Treasury are being consolidated and then run by BlackRock. Essentially, it's what they're going to be doing. And that's to ensure that this continues beyond any presidential administration, beyond what anyone says or does and totally outside. I mean, what's what's the purpose of a Fed chairman at this point? It doesn't make sense. And so they've asked them to steer tens of billions of dollars of bond purchases. And they are BlackRock is the world's largest money manager. They will purchase commercial mortgage backed securities on behalf of the New York Fed.
[00:09:55] They will determine which securities are guaranteed by Fannie, Freddie and Ginnie Mae. I don't even know. Ginnie Mae existed in BlackRock will execute all the trades. It's like man must be nice to me. BlackRock actually gets. Sweetheart deal, had that happen? I mean, do they? Did they open this up for RFP and people submitted their different proposals to the government for managing this? James, I mean, it was this a fair competition or a day again? BlackRock's gonna do it.
[00:10:22] Yeah. Open bidding process, right? Everybody's. Yeah. All these contracting companies submitting their bids now didn't quite happen that way. And BlackRock has it. As it turns out, it's much more connected than than anybody really knew. And it has their hands in well. I mean, they have their hands in just about every corporation which we'll get into. But yeah. Now they're they're holding the reins of power for what, U.S. monetary policy?
[00:10:48] They can. Yes. And so the purpose of this. Just so people understand what was done both in the bailout bill and also outside of the bailout bill, this is a combination of all of these things. This essentially means that that the presidential administration, Donald Trump, will have more control over what happens with the Fed. And it's not this in this implied control that everybody believes isn't going on. But Donald Trump doesn't have to kick and scream to get Jerome Powell to do anything anymore.
[00:11:22] I mean, they can affect that control through the special purpose vehicles, through these Organa orphanages, organizations that have been stood up and essentially the old apparatus like it doesn't matter anymore. It's like just eroding that, blurring the line. There is no line. Like the only line that matters is the one that goes up or down and it better be going up according to them. And that essentially puts the levers of power from Steve Manoogian directly in the hands of Donald Trump and Jared Kushner. So, yeah, I mean, why even have a Fed chairman? Well, what does that make Donald Gerard at this point?
[00:11:56] Yeah, the Fed chairman becomes a ceremonial role at this point, largely dead.
[00:12:01] So let's talk about BlackRock here, because this is something that we touched on a little bit last week, last weekend. So remember last week we talked about Kelly Loffler on the Senate Health Committee. She sold up to 3.1 million dollars in stock starting on the day that her committee was briefed by the CDC. And of course, her husband is Jue Jeffrey SPRECHER, who is the founder, chairman of CEO of Intercontinental Exchange, otherwise known as ICE. He's also the chairman of the New York Stock Exchange. Of course, ISIS, we pointed out last weekend, was backed as a startup by Goldman Sachs and Morgan Stanley in the year 2000. Shortly thereafter, SPRECHER was installed as CEO. Then ICE took over the New York Stock Exchange in 2012.
[00:12:48] And so that made SPRECHER the CEO of the NYSE. Then in 2014, SPRECHER purchased this Israeli company called Super Derivatives for 350 million dollars in all cash. It's based in Tel Aviv. It does a lot of business with, you know, companies like Deutsche Bank and Citigroup and Credit Suisse and Barclays. And so they are basically one of the many digital components that have allowed stock trades to be digitalized and fully automated.
[00:13:17] Well, isn't it funny how as of Monday, March 23rd, all U.S. stock markets officially closed their trading floor and went to purely electronic trading? Is that funny? Amazing. So, you know, it's better to have human traders on the floor. Most people agree with this. The problem with computers is they cause prices to fluctuate.
[00:13:39] They're also not you know, it's it's also like who knows what's actually going on, like who's in control of how the trading is taking place. And they've had problems before as well. There is this financial firm called Knight Capital where there was a glitch in the computer. People probably remember when this happened back in 2012. But it it essentially what did they do? It sold all of the stocks that it had bought the day before because of them, because of a glitch. So it bought all these stocks and made a bunch of money for Knight Capital. And then the next morning when it woke up, it sold them all. And yeah, they lost four hundred and forty million dollars over the course of of of a little under an hour. It was ten million dollars a minute in terms of what happened. I mean, my God. But that's that's like that's like the bad thing that happened to them. Think about all the the ways that this can be used to benefit them and not benefit you, which is really how the system is supposed to work.
[00:14:41] Yeah, because the average investor is someone who either invest directly or has a fund or they're not going to be looking at daily price fluctuations probably. And they're not going to be set to to, you know, cut their losses like these these computers are. And that's the other thing that computerized trading does is it will like once it's called a stop loss, when a stock price dips below a certain threshold, it will sell a percentage of its holdings. And so this is how you get part of how you get these wild price fluctuations. Hour by hour, you know, over the last three weeks, the market has been as volatile, reaching as many peaks and valleys as it does over a typical year long period. And this is due in large part because of this expansion in Internet online trading.
[00:15:28] Right. And essentially, the entire stock exchange is managed by a guy installed by Goldman Sachs. And a large portion of the electronic trading that is done is actually being done out of Israel by a super derivatives. And that's not the only company that does the electronic trades. But I mean. You know, this this idea that this is a big, free, open marketplace where any anybody can participate. And, you know, it's like, no, it's actually very Orwellian and controlled by a handful of people. In fact, just a couple of companies really sit at the top and think, people need to understand that you have to sort of I think a lot of our our guys understand how this works and have known for a while or at least maybe you've had the feeling that that's how this has been constructed. Well, let me prove it to you. So going back to BlackRock and Goldman Sachs.
[00:16:22] Right. They're not actually separate entities. BlackRock is the top investor in Goldman, along with Vanguard and strict State Street right after them. So together, Vanguard, BlackRock and State Street own 20 percent of Goldman Sachs. Goldman Sachs, in turn, is who did the startup for ICE and then installed SPRECHER is the NYSE CEO. So in effect, BlackRock controls Goldman and Goldman controls Hertz Stock Exchange. And it's pretty, pretty hilarious. And when you look at BlackRock itself, founded in nineteen eighty eight by Larry Fink, who is still the CEO, Larry Fink is Jewish. In fact, I'm just going to read the names and I will tell you if they're not Jewish. How about that. We'll just do it that way.
[00:17:05] It's easier to do it that way. So Larry Fink, Robert S. cappato, Susan Wagner, Barbara Novick, Ben Golub, Q Frater back, guys. A Gentile, Ralph Shlash Stein. You think that guy's a gentile, James? I don't know. That's a tough one. Jesus and Keith Anderson also a gentle so out of the founders of BlackRock, six out of eight are Jewish. So who's calling the shots now? Again, same rules apply. I'm just gonna read the names and I'll tell you if they're not Jewish. So Larry Fink, Robert Capital still around. Rob Al Goldstein, Ben Golub, still around. Gary Shevlin. Derek Stein. Marc Weidmann. Marc Wiseman. Those are basically the guys that sit on cardboard jazz.
[00:17:51] It didn't hear you call it. Any exceptions to the rule there? Yes. It seems like all these guys are Jewish. The entire corporate board of BlackRock, Jeff.
[00:18:02] Wow. And so, yeah, of course. And Larry Fink, it's just like, oh, my God, when you look at the look at this guy and think think told the firm's 14000 employees that he is instituting potentially the most aggressive diversity program in corporate America and sharing that, quote, A bunch of white men will no longer be running the world's largest money management firm. Yes. So like you guys, where it's basically Stein, Golombek, Goldstein Capital think weideman Weizman. It's like, oh, yeah, but not that, though. Like that's going to remain intact. Yeah.
[00:18:36] Yeah. And do you think they're only applying that rule internally or are they applying that to the many corporations they have controlling stakes in as we'll get to.
[00:18:44] I wonder I wonder if if that theory trickles down. Yeah. And it's I mean they're going to be trying to mean the fact that they're handing it off. Know, Jamie Diamond had some heart issues I think in the last couple of weeks.
[00:18:58] And there were some articles talking about who he had groomed as his predecessors or sorry as his successors. I meant to say and one of them is Joseph Pinto, who's a subpart of Jew, and another one is a woman. So Pinto looks like, you know, your typical like beaner replacement. But no, that's a subpart of Jew and then a woman who he's trying to bring up, who's like unmarried cat lady. Yes. She's also Jewish. And I think her name is Catherine Lake. I can't remember. But if you look her up, she's she's Jewish. And those are those are the successors for Jamie Diamond, J.P. Morgan's Jamie Diamond. If he decides to retire. So, yeah, I like this idea that. Oh, we got it. We got to diversify. No, there's nothing getting diversified. These are all still Jews in charge of all of it. So, you know, Fink has also said profits are an in no way consistent with purpose.
[00:19:49] In fact, profits and purpose are inextricably linked. What does he mean by that? What do you think he means? What do you think their purposes? Well, let's talk about their purpose. So you had, I think, along with Tom Barach Blackstone, which is different from Black Rock Blackstone, that's CEO Stephen Schwarzman and Goldman Sachs, Dina Powell were all invited to closed door sessions to discuss Jared Kushner's Middle East peace plan.
[00:20:17] L-o-l at peace plan. And we remember how what the rollout of that was. But think guy in charge of BlackRock. You know, he he was in that room. Tom Barach Blackstone. Goldman said it's funny that they're all there. And of course, Schwartzman was also selected to lead Trump's economic advisory team during the transition. But it's not just BlackRock of the fifty two senior executives of the largest American asset management firms, private equity funds and. Hedge funds such as Vanguard, Blackstone Group, Elliott Management, Charles Schwab, Renaissance Technologies being White Mellon, Millennium Management Warburg Pincus, Kohlberg Kravis Roberts, AQR Capital, Bain Capital, Apollo Global Management 36 or Jews or have Jewish spouses.
[00:21:03] So it's that roughly 70 percent.
[00:21:05] So to do 70 I think is how that works out. Just fucking disgusting. And those are the ones that, you know, we can look up and figure out. And a lot of that has changed. I think as time has gone on. But these guys are all also members of a secret society before you cringe. This is a real thing. Kappa Beta Fi Enga, look it up. It's publicly available, but it's a secret society for finance capital. It's been around actually since nineteen twenty nine prior to the stock market crash in twenty nine. And the Wall Street chapter apparently is the only chapter left in the membership is is publicly available. You have people like Michael Bloomberg, John Corer, Zine, Larry Fink, Richard Grasso, David Komansky, Sally Krawcheck, who I mentioned her before. Marc Lasry, Martin Lipton. Martin Lipton. Sounds since I could go right. Wrong. Wilbur Ross, Alan Schwarz, Robert Rubin, Mary SHAPIRO, Diana Taylor, who is the wife of Michael Bloomberg and the superintendent of New York State Banks. Warren Stephens. John C. Whitehead. Richard Fuld, who is the former chair and CEO of Lehman Brothers.
[00:22:19] You can look all these people up, but yeah, this is a this is a basically one of their little clubs. And I'm sure because this is publicly available and you can see some of the members they induct 20, 15 to 20 new members every year at a black tie dinner. I'm sure that. Do you really think that this is the only forum in which these people meet and this is a fun forum like this is where these people get together and and drink and socialize and connect with one another and network, actually. But the things that are said and the plans that are made are certainly not done in this manner. But I didn't even know about captivated Fi. I certainly didn't know about it. But it was formed in 1929 prior to the stock market crash. And their motto is Keeping alive the spirit of the good old days of 1928 in 1929. Well, that that kicked off a lot of the restructuring of the world economy. That's what Spetz into World War 2.
[00:23:17] Yeah, I know the good old days where profits were coming hot and heavy and very little oversight.
[00:23:22] So, yeah, Larry Fink is in the mix on this. He got Bloomberg in there, got John Corazón. You got all these these people in. The only reason I mention captivated Fi is because of Larry Fink and a lot of these these people that are all intermingled in so many ways.
[00:23:38] Sure. But Fink, I wonder how many of those people show up showed up in Jeffrey Epstein's black book, the AP, an interesting research project.
[00:23:45] Good question. I think is probably the most powerful man in the world. His company actually has 6.5 trillion dollars in assets. They are the single largest Shell shareholder in virtually any major corporation that you can think of. We'll go through the list here in a second. And it controls the nine DACs companies in Germany as well. So it's not just the United States, very deeply rooted in Germany and Austria. They're all over the world. It's they can influence the fate of entire cities and countries. BlackRock is they have 70 offices in 30 countries, clients in over 100 countries around the world. They are essentially the world's largest shadow bank due to its size and scope. I mean, just the math, just to put this into perspective, so people understand BlackRock is larger than Deutsche Bank, Goldman Sachs and JP Morgan combined. And they own those companies, too, like they own large controlling, not quite well, not controlling in the sense that you would think not 51 percent, but large enough where they can make things happen if they need to. They are the largest single shareholder also of BASF, Daimler, Lufthansa, Deutsche Bank and Allianz. And that's just in Germany. They they also have this massive data center in Washington state.
[00:25:16] There's a cluster of six thousand computers there that monitor the assets of over 170 pension funds, banks, foundations, insurance companies and others. These these computers watch interest rate changes, bank failures, look at natural disasters and, you know, look at every change in consequences, positive or negative. And of course, this system is called Aladdin and there are 17000 traders around the world that decide when to buy or sell assets. Based on what this data center spits out, it's the heart of BlackRock and they single handedly managed most of the money that is in private equity and hedge funds combined worldwide. The only other big company out there that owns just almost as much as them, they're dwarfed by half. But three trillion is is Vanguard. And so although almost all of their holdings are stocks, they are the largest shareholder in 50 percent of the world's third largest corporations. So they not only hold stocks, but they hold bonds, commodities, hedge funds and real estate. And yeah, I mean, according to an anonymous European insurer who wishes to remain anonymous and possibly alive as well, he said if you're looking to buy or sell something or invest, it's very difficult to get around BlackRock.
[00:26:36] That I mean, they basically, like, run the show. And yeah, yeah, it's huge.
[00:26:41] Yeah. And when you take a look at the toll, the type of companies they're involved in, it's very diversified, a lot of diverse assets here.
[00:26:48] They have 5 percent of Apple, 5 percent of Exxon Mobile, 6 percent of Google, 7 percent of Berkshire Hathaway. The list goes on and on, 7 percent of Petro China. So they're involved in just about every field you can imagine.
[00:27:01] Yeah. Johnson and Johnson. G.E., Chevron. JP Morgan. Wells Fargo. Procter and Gamble. Royal Dutch Shell. Nestlé. Walmart. Novartis. Roget, Toyota. China. Mobile.
[00:27:11] Like I mean, they they don't need like who needs sovereign nations and government. Like government is just like for these people, just something that's getting in the way and this consolidation of power in the center of power in the United States and basically installing BlackRock as the new operating system on top of the Fed and the Treasury is exactly I mean, it just put it all together and you can figure out what's going on.
[00:27:36] They own they own $58 billion worth of Microsoft, $54 billion worth of Apple. Forty five billion dollars worth of Amazon, $26 billion worth of Johnson and Johnson. Twenty four billion worth of Facebook. Twenty two billion worth of alphabet. Twenty two billion worth of Exon.
[00:27:54] Twenty two billion worth of JP Morgan. I mean, it's of Bircher Hathaway. It just goes on down the line. Pfizer, Visa, Intel, Netflix, Wal-Mart, Starbucks. They own they are the third largest shareholder of Lockheed Martin, second largest shareholder of Boeing, the fifth largest shareholder of General Dynamics. You have Raytheon, Northrop, McKesson, Huntington, Ingles, L-3 Technologies. Like this is all part of the the military industrial complex media.
[00:28:25] They are the second largest shareholder of AT&T, which now includes Turner Broadcasting, HBO, CNN and Warner Brothers. It's like this one company now might as well make it all simple. Walt Disney Company, which includes ABC, Fox News A and E, ESPN, Lucasfilm and Marvel. BlackRock is the second largest shareholder. Comcast Charter Communications, 21st Century Fox, which is now owned by Disney. Thompson, Reuters. CBS Dish Network. Viacom. Right. We're talking about the Black Rock with with Vioxx. I mean, and we've talked about the CEO of Viacom and how this is all blending together. And if you're wondering why BlackRock is the second largest shareholder for a lot of these positions, it's because, as I said, the first is often Vanguard.
[00:29:14] Vanguard has 41 one holdings with a total value of three trillion with top holdings in this order. Apple, Microsoft, Google, Amazon, JP Morgan, Facebook, Johnson. And it's all the same companies they own between the two of these companies. They own a huge amount. Now, people would say, oh, yeah, it's only 6 percent. It's only a very small portion of the total value of of the company. It's like. But if they pulled out of one of these companies or decided to do essentially BTX against an American corporation, that's the end of that. So all of these companies have to be walking in lockstep with whatever give Larry Fink whatever the fuck he wants. So if you're wondering why, you can have very quickly overnight a nationwide D platforming campaign where it's almost as if every single company is on the same conference call to decide what action to take. And it's not like they're confused about what they need to do. Like in many cases, they just know what they're supposed to do. But if you cut a lot of people by surprise in 2016, that it's like, wow, all these companies are operating in such a coordinated fashion. Well, now you get why like now you understand why that happens.
[00:30:27] Now you understand why nobody has to communicate with one another about putting more black people in commercials for each one of the products that is manufactured by many of these companies. Like they all are working in lockstep on this. It's all it's all like when you're looking at this and you think because I think a lot of people think that America's this. Big collection of free market capitalism where all these companies are competing with with one another and it's just like let the person who's best at doing product win.
[00:30:57] It's like, that's not how that works at all. No, no, no.
[00:31:02] And they've they've informed you what their ideology is. Right. BlackRock has that they want fewer white people in positions of power and positions of influence. And of course, as we know, this is not going to to be applied towards the white people that are in charge of BlackRock.
[00:31:18] You know, run the clock out 10, 20 years. And it's going to look very much the same at the top of BlackRock. Maybe a few tokens here in there. But what they will do is they will ensure that the positions of power in these companies they own and control are not filled by white men, that white mid-level executives don't have the opportunity to advanced beyond their position. And that is where you will stay in people, you know, blacks and rounds and Jews will be promoted all around you and you will not have that position or the ability to rise to the level of a CEO, one of their companies, and they're going to make sure of that.
[00:31:54] But even if you climb that high, I mean, it sort of speaks to what sort of moral turpitude you might have and the people that do get into these positions. We did name a couple of gentiles. I mean, it's like those guys are totally down with whatever they're going. Definitely. Yeah. So their position. So looking back at this a little bit. So just because you're an asset manager, that doesn't mean that you have direct control over any given company. That's the point that I was making before. But if they have that much financial influence over a company's balance sheet and the personal wealth of the company executives, if you're in charge of running a company and you got a call from Larry, think you're gonna take that call, you're not going to ignore that phone call and to declare it, Larry, think owns like most of your company. And so their position as this dominant shareholder allows them to funnel money by way of cash, can't campaign contributions to PACs and to politicians of note. So this is the system when we talk about the system. This is the system. So you have President Donald Trump. A lot of his donors are BlackRock is the largest or third largest or second largest shareholder. Mike Pence. A lot of his donors.
[00:33:07] It's the same thing when you look at Mitch McConnell's top donors. It's the same thing whether it's a trade group, United Parcel Service, Eli Lilly, MetLife, BlackRock is either the first, second or third largest shareholder in those companies. Same with Mike Pence. Same with Donald Trump. Same with Kevin McCarthy. Same with Chuck Grassley. It goes on and on and on. And, you know, like Chuck Grassley is number one donor. Blue Cross Blue Shield, which includes Anthem BlackRock is the first largest shareholder prizing communications. BlackRock second largest shareholder, Comcast. BlackRock, second largest shareholder.
[00:33:43] Well, you're talking about Oracle or Citigroup or Federated Investors. I mean, these are all the donors to these political candidates, either in the form of super PACs or indirect political contributions. So do you think Mitch McConnell and Mike Pence and Donald Trump and Kevin McCarthy and Chuck Grassley are giving Larry Fink whatever the fuck he wants? Of course, they're being they give a fuck about, you know. Do you think if Larry Fink says, yeah, you got to. You got to start promoting like black people like we're doing on the TV? It's what do you think these guys are gonna do it? They you don't even have to tell them. But there are probably some cases where it's like, yeah, we got to get all of these people in line saying the same thing at the same time in a coordinated way.
[00:34:27] And so make the call, make it happen. But otherwise, I mean, these guys are just maiming off of each other, you know, and pushing it in the same direction. This is why this is why you will not succeed at trying to climb the political ladder. We still the tedious guys were talking about this on Friday, that apparently there are still people out there who know they're not quite at the Grug level, like still going. Magga for the president. But they're like, how do we like mount political opposition and run candidate to get in? And, you know, wave magic wand, defeat this political machine. It's like a guy like that's not happening. And I can say that for certain, because we know we've tried that already. It did not succeed. It cannot succeed in a system that's constructed in this way. And so if you still think that you can just go out there and, you know, have the right rhetoric and that's going to get you to the top, and that's how you defeat the whole estate, know, the whole system has been constructed to keep you from even getting past the first post.
[00:35:29] Yeah. I mean, just think about it as we see by Kevin McCarthy, for example, is in the house.
[00:35:35] And this is something that people have been been talking about is, oh, let's get fined a very rural white districts and run people for office there. And surely the people will be receptive to that message. And yeah, the people probably will be receptive to that message. But when your opposition, as we're seeing in the case with Thomas Massie, for example, when you're opposition can come in with big endorsements and big money and basically drown you out, then like what good can be done? Right. Because if you were to run for some office, let's say, in some rural white area and have good appeal to people, fine, great.
[00:36:09] But you also need money to run that race. And when Black is able to muster up, you know, one hundred thousand dollars in donations from each of Goldman Sachs, Oracle, Citigroup, BlueCross, Comcast, cetera, for your opponent, you're just going to be smothered and money.
[00:36:25] It plays such an integral role in American politics that that they're trying to run up against that system. As we say, BlackRock being the system, it's going to be near impossible in any kind of meaningful way.
[00:36:37] But what, James. But what if you have the perfect takes and you have the hottest takes and you can go out and you can just convince them that you're right and they're wrong?
[00:36:46] I mean, you know, I may know something about this whole running for office thing and and getting in and then having the hammer swoop down and it's all that. No, you actually didn't.
[00:36:57] And you're disqualified and barred from the barred from the party, especially especially now when they've seen Trump run on this rhetoric. And then he closed the door behind him and said, oh, yeah, we're gonna get we're going to gay up. The Republican Party. Now, this is not happening. It's just not happened. Right. Like it's that was and that was the premise.
[00:37:16] Right. Was that. And just quickly that Trump was going to get in and and then he was going to usher in. Hold the door open and usher in this new GOP, this new nationalist group of young people that would take over the GOP. But instead of closing the door behind him is really the perfect metaphor. And yeah, I mean, beating on that door, looking the window of that door, trying to get in that door, crying for attention from those that have made it through the door is not going to get you anywhere.
xxxxxxxxxxxxx
Wikipedia SARS conspiracy theory
The SARS conspiracy theory began to emerge during the severe acute respiratory syndrome (SARS) outbreak in China in the spring of 2003, when Sergei Kolesnikov,[1] a Russian scientist and a member of the Russian Academy of Medical Sciences, first publicized his claim that the SARS coronavirus is a synthesis of measles and mumps. According to Kolesnikov, this combination cannot be formed in the natural world and thus the SARS virus must have been produced under laboratory conditions. Another Russian scientist, Nikolai Filatov, head of Moscow's epidemiological services, had earlier commented that the SARS virus was probably man-made.[2]
However, independent labs concluded these claims to be premature since the SARS virus is a coronavirus, whereas measles and mumps are paramyxoviruses. The primary differences between a coronavirus and a paramyxovirus are in their structures and method of infection, thus making it implausible for a coronavirus to have been created from two paramyxoviruses.
The widespread reporting of claims by Kolesnokov and Filatov caused controversy in many Chinese internet discussion boards and chat rooms. Many Chinese believed that the SARS virus could be a biological weapon manufactured by the United States, which perceived China as a potential threat.[8] The failure to find the source of the SARS virus further convinced these people and many more that SARS was artificially synthesised and spread by some individuals and even governments. Circumstantial evidence suggests that the SARS virus crossed over to humans from Asian palm civets ("civet cats"), a type of animal that is often killed and eaten in Guangdong, where SARS was first discovered.
Supporters of the conspiracy theory suggest that SARS caused the most serious harm in mainland China, Hong Kong, Taiwan and Singapore, regions where most Chinese reside, while the United States, Europe and Japan were not affected as much. However, the highest mortality from SARS outside of China occurred in Canada where 43 died. Conspiracists further point out that SARS has an average mortality rate of around 10% around the world, but no one died in the United States from SARS, despite the fact that there were 8 confirmed cases out of 27 probable cases (10% of 8 people is less than 1 person). Regarding reasons why SARS patients in the United States experienced a relatively mild illness, the U.S. Centers for Disease Control has explained that anybody with fever and a respiratory symptom who had traveled to an affected area was included as a SARS patient in the U.S., even though many of these were found to have had other respiratory illnesses.
In October 2003, Tong Zeng, a Chinese lawyer and a volunteer in a 1998 Chinese-American medical cooperation program, published a book[16] that again speculated that SARS could be a biological weapon developed by the United States against China. In the book, Tong disclosed that in the 1990s, many American research groups collected thousands of blood and DNA samples and specimens of mainland Chinese (including 5,000 DNA samples from twins) through numerous joint research projects carried out in China. These samples were then sent back to the United States for further research, and could be used in developing biological weapons targeting Chinese. These samples came from 22 provinces in China, all of which were hit by SARS in 2003. Only provinces like Yunnan, Guizhou, Hainan, Tibet, and Xinjiang were left out, and all these provinces suffered less severely during the SARS outbreak. The author suspects that Japan is also involved, as many Japanese factories in Guangdong in the 1990s made it compulsory for all workers to have blood tests in the factory annually, rather than asking workers to go to local hospitals for blood tests and a proper physical examination. However, Tong Zeng admits that these are only speculations, and he does not have any concrete proof from the study of the virus's genetic sequence.[17]
The two scientists named above expressed the possibility that the SARS virus was man-made.[18]
Coronaviruses similar to SARS have been found in bats in China, suggesting they may be their natural reservoir.[19]
xxxxxxxxxxxxxxxxxxxxxxx
MEMRI
The Egyptian government daily, Al-Ahram, echoes Qadhafi's accusations against the US and Israel: "Our brother, the Colonel Mu'ammar Al-Qadhafi, the leader of the Libyan revolution, revealed that two years ago Libyan children in the city of Benghazi suffered from the most abominable crime in the history of mankind, when foreign nurses injected them with the AIDS virus, while pretending to immunize them." "In a speech given during the closing session of The Special African Summit for the Fight Against the AIDS Epidemic... Qadhafi said that Libya will hand over all information regarding this vile crime to the World Health Organization (WHO) and to other relevant international organizations so the world will know of the plot, which bear no mercy for children and from which the Libyan people suffer." "Qadhafi added that there are those who think that the CIA or the Israeli Mossad were behind this crime. He emphasized that these children were transported to Europe for treatment and that European health authorities are well aware of the matter. Other [infected] children are treated by Libyan clinics." "Qadhafi added that this act, which is a malicious sex crime, reveals the ugly face of those who introduced the AIDS virus to Africa in order to exhaust its strength and deplete its resources with the intention of gaining control over Africa. He remarked that Africa has turned into a market of high demand for pharmaceutical and other AIDS-treatment medical products. He claimed that international monopolies strive to continue disseminating the AIDS virus as long as possible in order to double their profits from sales of pharmaceutical products, which inhibit the effects of the disease." "Qadhafi clarified that world health authorities stated more then once that they were able to isolate the AIDS virus, meaning that they made considerable progress regarding methods to control the virus. He explained that medical laboratories can achieve a perfect treatment for this disease and even find immunization for it, but big capitalist corporations prevent this from taking place in order to maintain their large profits." "Qadhafi added that the smallpox virus, which the World Health Organization declared eradicated from the world, is still kept in CIA laboratories. He asked why the U.S. is not handing it over to the World Health Organization and explained that the reason was the U.S. intention to use it for biological warfare. Qadhafi stated that Libya will raise this humanitarian issue in international fora and [argued] that nations and governments must take a firm stand on such matters which have implications on the fate of nations."
xxxxxxxxxxxxxxxxxxxxxxx
The Zionist Communist Takeover Of
America - 45 Declared Goals
By Jeff Rense
4-24-18
On January 10, 1963, the House of Representatives and later the Senate began reviewing a document entitled 'Communist Goals for Taking Over America.' It contained an agenda of 45 separate issues (attacks and techniques) that, in hindsight, were quite shocking then and equally stunning today.
Over the last 50 plus years since this list was introduced in the House, many things have changed, among them that the Soviet Union is gone and Communism isn't mentioned by the controlled MSM anymore. Why? Because the founders of Communism, World Zionism, is now the dominant force in the Western World and controls virtually every major geopolitical, social, cultural and commercial aspect of our existence.
Most importantly, about 27 of the 45 Communist (Zionist) Goals on the original list have been or are being achieved. (History has largely retired the other 18). These remaining 27 items will…or should…shock you. It is essential to also understand that world Zionism CREATED Communism, took down Russia, set up the Soviet Union and created two World Wars in which over 100 million died. Whether the term is ‘Communism' or 'Bolshevism' or ‘Socialism' or ‘Marxism' they all emanate from one source - World Zionism. That must never be forgotten.
So, as you read through this list, understand and never forget that these goals, most now 100% implemented, are all ZIONIST goals.
Here, in part, are the most blatant Zionist Communist achievements listed in that original list of 45 Goals. Read this group very carefully…these are the most sweeping, revolutionary, devastating and deadly Goals on the list from 1963. ( I will list all original 45 further down the page.)
Here we go...
4. Permit free trade between all nations regardless of Communist affiliation and regardless of whether or not items could be used for war.
11. Promote the UN as the only hope for mankind.
13. Do away with all loyalty oaths.
15. Capture one or both of the political parties in the United States.
16. Use technical decisions of the courts to weaken basic American institutions by claiming their activities violate civil rights.
17. Get control of the schools. Use them as transmission belts for socialism and current Communist propaganda. Soften the curriculum. Get control of teachers' associations. Put the party line in textbooks.
18. Gain control of all student newspapers.
19. Use student riots to foment public protests against programs or organizations which are under Communist attack.
20. Infiltrate the press. Get control of book-review assignments, editorial writing, policy-making positions.
21. Gain control of key positions in radio, TV, and motion pictures.
22. Continue discrediting American culture by degrading all forms of artistic expression. An American Communist cell was told to "eliminate all good sculpture from parks and buildings, substitute shapeless, awkward and meaningless forms."
23. Control art critics and directors of art museums. "Our plan is to promote ugliness, repulsive, meaningless art."
24. Eliminate all laws governing obscenity by calling them "censorship" and a violation of free speech and free press.
25. Break down cultural standards of morality by promoting pornography and obscenity in books, magazines, motion pictures, radio, and TV.
26. Present homosexuality, degeneracy and promiscuity as "normal, natural, healthy."
27. Discredit the Bible and emphasize the need for intellectual maturity, which does not need a "religious crutch."
28. Eliminate prayer or any phase of religious expression in the schools on the ground that it violates the principle of "separation of church and state."
29. Discredit the American Constitution by calling it inadequate, old-fashioned, out of step with modern needs, a hindrance to cooperation between nations on a worldwide basis.
30. Discredit the American Founding Fathers. Present them as selfish aristocrats who had no concern for the "common man."
31. Belittle all forms of American culture and discourage the teaching of American history on the ground that it was only a minor part of the "big picture." Give more emphasis to Russian history since the Communists took over.
32. Support any socialist movement to give centralized control over any part of the culture--education, social agencies, welfare programs, mental health clinics, etc.
37. Infiltrate and gain control of big business.
38. Transfer some of the powers of arrest from the police to social agencies. Treat all behavioral problems as psychiatric disorders which no one but psychiatrists can understand [or treat].
39. Dominate the psychiatric profession and use mental health laws as a means of gaining coercive control over those who oppose Communist goals.
40. Discredit the family as an institution. Encourage promiscuity and easy divorce.
41. Emphasize the need to raise children away from the negative influence of parents. Attribute prejudices, mental blocks and retarding of children to suppressive influence of parents.
42. Create the impression that violence and insurrection are legitimate aspects of the American tradition; that students and special-interest groups should rise up and use ["]united force["] to solve economic, political or social problems.
THESE are the key Communist Goals on the list and demonstrate clearly how America has been subverted and torn apart from the inside out. You can see the entire, original list of 45 down below…a list that was entered into the Congressional Record in 1963. - Jeff Rense
Comment From Founders' America
[email protected]
12-7-2 Jeff...adding a couple of my own numbers...
46. Import anti-white racists from the Third World, via an open-borders policy, then force their integration to divide and conquer white Western civilization in North America.
47. Feminize men and disarm both the citizenry and military; especially disarm white males.
xxxxxxxxxxxxxxxxxxxxx
A SARS-like cluster of circulating bat coronaviruses shows potential for human emergence
Nature
The emergence of severe acute respiratory syndrome coronavirus (SARS-CoV) and Middle East respiratory syndrome (MERS)-CoV underscores the threat of cross-species transmission events leading to outbreaks in humans. Here we examine the disease potential of a SARS-like virus, SHC014-CoV, which is currently circulating in Chinese horseshoe bat populations1. Using the SARS-CoV reverse genetics system2, we generated and characterized a chimeric virus expressing the spike of bat coronavirus SHC014 in a mouse-adapted SARS-CoV backbone. The results indicate that group 2b viruses encoding the SHC014 spike in a wild-type backbone can efficiently use multiple orthologs of the SARS receptor human angiotensin converting enzyme II (ACE2), replicate efficiently in primary human airway cells and achieve in vitro titers equivalent to epidemic strains of SARS-CoV. Additionally, in vivo experiments demonstrate replication of the chimeric virus in mouse lung with notable pathogenesis. Evaluation of available SARS-based immune-therapeutic and prophylactic modalities revealed poor efficacy; both monoclonal antibody and vaccine approaches failed to neutralize and protect from infection with CoVs using the novel spike protein. On the basis of these findings, we synthetically re-derived an infectious full-length SHC014 recombinant virus and demonstrate robust viral replication both in vitro and in vivo. Our work suggests a potential risk of SARS-CoV re-emergence from viruses currently circulating in bat populations.
Main
The emergence of SARS-CoV heralded a new era in the cross-species transmission of severe respiratory illness with globalization leading to rapid spread around the world and massive economic impact3,4. Since then, several strains—including influenza A strains H5N1, H1N1 and H7N9 and MERS-CoV—have emerged from animal populations, causing considerable disease, mortality and economic hardship for the afflicted regions5. Although public health measures were able to stop the SARS-CoV outbreak4, recent metagenomics studies have identified sequences of closely related SARS-like viruses circulating in Chinese bat populations that may pose a future threat1,6. However, sequence data alone provides minimal insights to identify and prepare for future prepandemic viruses. Therefore, to examine the emergence potential (that is, the potential to infect humans) of circulating bat CoVs, we built a chimeric virus encoding a novel, zoonotic CoV spike protein—from the RsSHC014-CoV sequence that was isolated from Chinese horseshoe bats1—in the context of the SARS-CoV mouse-adapted backbone. The hybrid virus allowed us to evaluate the ability of the novel spike protein to cause disease independently of other necessary adaptive mutations in its natural backbone. Using this approach, we characterized CoV infection mediated by the SHC014 spike protein in primary human airway cells and in vivo, and tested the efficacy of available immune therapeutics against SHC014-CoV. Together, the strategy translates metagenomics data to help predict and prepare for future emergent viruses.
The sequences of SHC014 and the related RsWIV1-CoV show that these CoVs are the closest relatives to the epidemic SARS-CoV strains (Fig. 1a,b); however, there are important differences in the 14 residues that bind human ACE2, the receptor for SARS-CoV, including the five that are critical for host range: Y442, L472, N479, T487 and Y491 (ref. 7). In WIV1, three of these residues vary from the epidemic SARS-CoV Urbani strain, but they were not expected to alter binding to ACE2 (Supplementary Fig. 1a,b and Supplementary Table 1). This fact is confirmed by both pseudotyping experiments that measured the ability of lentiviruses encoding WIV1 spike proteins to enter cells expressing human ACE2 (Supplementary Fig. 1) and by in vitro replication assays of WIV1-CoV (ref. 1). In contrast, 7 of 14 ACE2-interaction residues in SHC014 are different from those in SARS-CoV, including all five residues critical for host range (Supplementary Fig. 1c and Supplementary Table 1). These changes, coupled with the failure of pseudotyped lentiviruses expressing the SHC014 spike to enter cells (Supplementary Fig. 1d), suggested that the SHC014 spike is unable to bind human ACE2. However, similar changes in related SARS-CoV strains had been reported to allow ACE2 binding7,8, suggesting that additional functional testing was required for verification. Therefore, we synthesized the SHC014 spike in the context of the replication-competent, mouse-adapted SARS-CoV backbone (we hereafter refer to the chimeric CoV as SHC014-MA15) to maximize the opportunity for pathogenesis and vaccine studies in mice (Supplementary Fig. 2a). Despite predictions from both structure-based modeling and pseudotyping experiments, SHC014-MA15 was viable and replicated to high titers in Vero cells (Supplementary Fig. 2b). Similarly to SARS, SHC014-MA15 also required a functional ACE2 molecule for entry and could use human, civet and bat ACE2 orthologs (Supplementary Fig. 2c,d). To test the ability of the SHC014 spike to mediate infection of the human airway, we examined the sensitivity of the human epithelial airway cell line Calu-3 2B4 (ref. 9) to infection and found robust SHC014-MA15 replication, comparable to that of SARS-CoV Urbani (Fig. 1c). To extend these findings, primary human airway epithelial (HAE) cultures were infected and showed robust replication of both viruses (Fig. 1d). Together, the data confirm the ability of viruses with the SHC014 spike to infect human airway cells and underscore the potential threat of cross-species transmission of SHC014-CoV.
Figure 1: SARS-like viruses replicate in human airway cells and produce in vivo pathogenesis.
figure1
(a) The full-length genome sequences of representative CoVs were aligned and phylogenetically mapped as described in the Online Methods. The scale bar represents nucleotide substitutions, with only bootstrap support above 70% being labeled. The tree shows CoVs divided into three distinct phylogenetic groups, defined as α-CoVs, β-CoVs and γ-CoVs. Classical subgroup clusters are marked as 2a, 2b, 2c and 2d for the β-CoVs and as 1a and 1b for the α-CoVs. (b) Amino acid sequences of the S1 domains of the spikes of representative β-CoVs of the 2b group, including SARS-CoV, were aligned and phylogenetically mapped. The scale bar represents amino acid substitutions. (c,d) Viral replication of SARS-CoV Urbani (black) and SHC014-MA15 (green) after infection of Calu-3 2B4 cells (c) or well-differentiated, primary air-liquid interface HAE cell cultures (d) at a multiplicity of infection (MOI) of 0.01 for both cell types. Samples were collected at individual time points with biological replicates (n = 3) for both Calu-3 and HAE experiments. (e,f) Weight loss (n = 9 for SARS-CoV MA15; n = 16 for SHC014-MA15) (e) and viral replication in the lungs (n = 3 for SARS-CoV MA15; n = 4 for SHC014-MA15) (f) of 10-week-old BALB/c mice infected with 1 × 104 p.f.u. of mouse-adapted SARS-CoV MA15 (black) or SHC014-MA15 (green) via the intranasal (i.n.) route. (g,h) Representative images of lung sections stained for SARS-CoV N antigen from mice infected with SARS-CoV MA15 (n = 3 mice) (g) or SHC014-MA15 (n = 4 mice) (h) are shown. For each graph, the center value represents the group mean, and the error bars define the s.e.m. Scale bars, 1 mm.
Full size image
To evaluate the role of the SHC014 spike in mediating infection in vivo, we infected 10-week-old BALB/c mice with 104 plaque-forming units (p.f.u.) of either SARS-MA15 or SHC014-MA15 (Fig. 1e–h). Animals infected with SARS-MA15 experienced rapid weight loss and lethality by 4 d post infection (d.p.i.); in contrast, SHC014-MA15 infection produced substantial weight loss (10%) but no lethality in mice (Fig. 1e). Examination of viral replication revealed nearly equivalent viral titers from the lungs of mice infected with SARS-MA15 or SHC014-MA15 (Fig. 1f). Whereas lungs from the SARS-MA15–infected mice showed robust staining in both the terminal bronchioles and the lung parenchyma 2 d.p.i. (Fig. 1g), those of SHC014-MA15–infected mice showed reduced airway antigen staining (Fig. 1h); in contrast, no deficit in antigen staining was observed in the parenchyma or in the overall histology scoring, suggesting differential infection of lung tissue for SHC014-MA15 (Supplementary Table 2). We next analyzed infection in more susceptible, aged (12-month-old) animals. SARS-MA15–infected animals rapidly lost weight and succumbed to infection (Supplementary Fig. 3a,b). SHC014-MA15 infection induced robust and sustained weight loss, but had minimal lethality. Trends in the histology and antigen staining patterns that we observed in young mice were conserved in the older animals (Supplementary Table 3). We excluded the possibility that SHC014-MA15 was mediating infection through an alternative receptor on the basis of experiments using Ace2−/− mice, which did not show weight loss or antigen staining after SHC014-MA15 infection (Supplementary Fig. 4a,b and Supplementary Table 2). Together, the data indicate that viruses with the SHC014 spike are capable of inducing weight loss in mice in the context of a virulent CoV backbone.
Given the preclinical efficacy of Ebola monoclonal antibody therapies, such as ZMApp10, we next sought to determine the efficacy of SARS-CoV monoclonal antibodies against infection with SHC014-MA15. Four broadly neutralizing human monoclonal antibodies targeting SARS-CoV spike protein had been previously reported and are probable reagents for immunotherapy11,12,13. We examined the effect of these antibodies on viral replication (expressed as percentage inhibition of viral replication) and found that whereas wild-type SARS-CoV Urbani was strongly neutralized by all four antibodies at relatively low antibody concentrations (Fig. 2a–d), neutralization varied for SHC014-MA15. Fm6, an antibody generated by phage display and escape mutants11,12, achieved only background levels of inhibition of SHC014-MA15 replication (Fig. 2a). Similarly, antibodies 230.15 and 227.14, which were derived from memory B cells of SARS-CoV–infected patients13, also failed to block SHC014-MA15 replication (Fig. 2b,c). For all three antibodies, differences between the SARS and SHC014 spike amino acid sequences corresponded to direct or adjacent residue changes found in SARS-CoV escape mutants (fm6 N479R; 230.15 L443V; 227.14 K390Q/E), which probably explains the absence of the antibodies' neutralizing activity against SHC014. Finally, monoclonal antibody 109.8 was able to achieve 50% neutralization of SHC014-MA15, but only at high concentrations (10 μg/ml) (Fig. 2d). Together, the results demonstrate that broadly neutralizing antibodies against SARS-CoV may only have marginal efficacy against emergent SARS-like CoV strains such as SHC014.
Figure 2: SARS-CoV monoclonal antibodies have marginal efficacy against SARS-like CoVs.
figure2
(a–d) Neutralization assays evaluating efficacy (measured as reduction in the number of plaques) of a panel of monoclonal antibodies, which were all originally generated against epidemic SARS-CoV, against infection of Vero cells with SARS-CoV Urbani (black) or SHC014-MA15 (green). The antibodies tested were fm6 (n = 3 for Urbani; n = 5 for SHC014-MA15)11,12 (a), 230.15 (n = 3 for Urbani; n = 2 for SHC014-MA15) (b), 227.15 (n = 3 for Urbani; n = 5 for SHC014-MA15) (c) and 109.8 (n = 3 for Urbani; n = 2 for SHC014-MA15)13 (d). Each data point represents the group mean and error bars define the s.e.m. Note that the error bars in SARS-CoV Urbani–infected Vero cells in b,c are overlapped by the symbols and are not visible.
Full size image
To evaluate the efficacy of existing vaccines against infection with SHC014-MA15, we vaccinated aged mice with double-inactivated whole SARS-CoV (DIV). Previous work showed that DIV could neutralize and protect young mice from challenge with a homologous virus14; however, the vaccine failed to protect aged animals in which augmented immune pathology was also observed, indicating the possibility of the animals being harmed because of the vaccination15. Here we found that DIV did not provide protection from challenge with SHC014-MA15 with regards to weight loss or viral titer (Supplementary Fig. 5a,b). Consistent with a previous report with other heterologous group 2b CoVs15, serum from DIV-vaccinated, aged mice also failed to neutralize SHC014-MA15 (Supplementary Fig. 5c). Notably, DIV vaccination resulted in robust immune pathology (Supplementary Table 4) and eosinophilia (Supplementary Fig. 5d–f). Together, these results confirm that the DIV vaccine would not be protective against infection with SHC014 and could possibly augment disease in the aged vaccinated group.
In contrast to vaccination of mice with DIV, the use of SHC014-MA15 as a live, attenuated vaccine showed potential cross-protection against challenge with SARS-CoV, but the results have important caveats. We infected young mice with 104 p.f.u. of SHC014-MA15 and observed them for 28 d. We then challenged the mice with SARS-MA15 at day 29 (Supplementary Fig. 6a). The prior infection of the mice with the high dose of SHC014-MA15 conferred protection against challenge with a lethal dose of SARS-MA15, although there was only a minimal SARS-CoV neutralization response from the antisera elicited 28 d after SHC014-MA15 infection (Supplementary Fig. 6b, 1:200). In the absence of a secondary antigen boost, 28 d.p.i. represents the expected peak of antibody titers and implies that there will be diminished protection against SARS-CoV over time16,17. Similar results showing protection against challenge with a lethal dose of SARS-CoV were observed in aged BALB/c mice with respect to weight loss and viral replication (Supplementary Fig. 6c,d). However, the SHC014-MA15 infection dose of 104 p.f.u. induced >10% weight loss and lethality in some aged animals (Fig. 1 and Supplementary Fig. 3). We found that vaccination with a lower dose of SHC014-MA15 (100 p.f.u.), did not induce weight loss, but it also failed to protect aged animals from a SARS-MA15 lethal dose challenge (Supplementary Fig. 6e,f). Together, the data suggest that SHC014-MA15 challenge may confer cross-protection against SARS-CoV through conserved epitopes, but the required dose induces pathogenesis and precludes use as an attenuated vaccine.
Having established that the SHC014 spike has the ability to mediate infection of human cells and cause disease in mice, we next synthesized a full-length SHC014-CoV infectious clone based on the approach used for SARS-CoV (Fig. 3a)2. Replication in Vero cells revealed no deficit for SHC014-CoV relative to that for SARS-CoV (Fig. 3b); however, SHC014-CoV was significantly (P < 0.01) attenuated in primary HAE cultures at both 24 and 48 h after infection (Fig. 3c). In vivo infection of mice demonstrated no significant weight loss but showed reduced viral replication in lungs of full-length SHC014-CoV infection, as compared to SARS-CoV Urbani (Fig. 3d,e). Together, the results establish the viability of full-length SHC014-CoV, but suggest that further adaptation is required for its replication to be equivalent to that of epidemic SARS-CoV in human respiratory cells and in mice.
Figure 3: Full-length SHC014-CoV replicates in human airways but lacks the virulence of epidemic SARS-CoV.
figure3
(a) Schematic of the SHC014-CoV molecular clone, which was synthesized as six contiguous cDNAs (designated SHC014A, SHC014B, SHC014C, SHC014D, SHC014E and SHC014F) flanked by unique BglI sites that allowed for directed assembly of the full-length cDNA expressing open reading frames (for 1a, 1b, spike, 3, envelope, matrix, 6–8 and nucleocapsid). Underlined nucleotides represent the overhang sequences formed after restriction enzyme cleavage. (b,c) Viral replication of SARS-CoV Urbani (black) or SHC014-CoV (green) after infection of Vero cells (b) or well-differentiated, primary air-liquid interface HAE cell cultures (c) at an MOI of 0.01. Samples were collected at individual time points with biological replicates (n = 3) for each group. Data represent one experiment for both Vero and HAE cells. (d,e) Weight loss (n = 3 for SARS-CoV MA15, n = 7 for SHC014-CoV; n = 6 for SARS-Urbani) (d) and viral replication in the lungs (n = 3 for SARS-Urbani and SHC014-CoV) (e) of 10-week-old BALB/c mice infected with 1 × 105 p.f.u. of SARS-CoV MA15 (gray), SHC014-CoV (green) or SARS-CoV Urbani (black) via the i.n. route. Each data point represents the group mean, and error bars define the s.e.m. **P < 0.01 and ***P < 0.001 using two-tailed Student's t-test of individual time points.
Full size image
During the SARS-CoV epidemic, links were quickly established between palm civets and the CoV strains that were detected in humans4. Building on this finding, the common emergence paradigm argues that epidemic SARS-CoV originated as a bat virus, jumped to civets and incorporated changes within the receptor-binding domain (RBD) to improve binding to civet Ace2 (ref. 18). Subsequent exposure to people in live-animal markets permitted human infection with the civet strain, which, in turn, adapted to become the epidemic strain (Fig. 4a). However, phylogenetic analysis suggests that early human SARS strains appear more closely related to bat strains than to civet strains18. Therefore, a second paradigm argues that direct bat-human transmission initiated SARS-CoV emergence and that palm civets served as a secondary host and reservoir for continued infection (Fig. 4b)19. For both paradigms, spike adaptation in a secondary host is seen as a necessity, with most mutations expected to occur within the RBD, thereby facilitating improved infection. Both theories imply that pools of bat CoVs are limited and that host-range mutations are both random and rare, reducing the likelihood of future emergence events in humans.
Figure 4: Emergence paradigms for coronaviruses.
figure4
Coronavirus strains are maintained in quasi-species pools circulating in bat populations. (a,b) Traditional SARS-CoV emergence theories posit that host-range mutants (red circle) represent random and rare occurrences that permit infection of alternative hosts. The secondary-host paradigm (a) argues that a nonhuman host is infected by a bat progenitor virus and, through adaptation, facilitates transmission to humans; subsequent replication in humans leads to the epidemic viral strain. The direct paradigm (b) suggests that transmission occurs between bats and humans without the requirement of an intermediate host; selection then occurs in the human population with closely related viruses replicating in a secondary host, permitting continued viral persistence and adaptation in both. (c) The data from chimeric SARS-like viruses argue that the quasi-species pools maintain multiple viruses capable of infecting human cells without the need for mutations (red circles). Although adaptations in secondary or human hosts may be required for epidemic emergence, if SHC014 spike–containing viruses recombined with virulent CoV backbones (circles with green outlines), then epidemic disease may be the result in humans. Existing data support elements of all three paradigms.
Full size image
Although our study does not invalidate the other emergence routes, it does argue for a third paradigm in which circulating bat CoV pools maintain 'poised' spike proteins that are capable of infecting humans without mutation or adaptation (Fig. 4c). This hypothesis is illustrated by the ability of a chimeric virus containing the SHC014 spike in a SARS-CoV backbone to cause robust infection in both human airway cultures and in mice without RBD adaptation. Coupled with the observation of previously identified pathogenic CoV backbones3,20, our results suggest that the starting materials required for SARS-like emergent strains are currently circulating in animal reservoirs. Notably, although full-length SHC014-CoV probably requires additional backbone adaption to mediate human disease, the documented high-frequency recombination events in CoV families underscores the possibility of future emergence and the need for further preparation.
To date, genomics screens of animal populations have primarily been used to identify novel viruses in outbreak settings21. The approach here extends these data sets to examine questions of viral emergence and therapeutic efficacy. We consider viruses with the SHC014 spike a potential threat owing to their ability to replicate in primary human airway cultures, the best available model for human disease. In addition, the observed pathogenesis in mice indicates a capacity for SHC014-containing viruses to cause disease in mammalian models, without RBD adaptation. Notably, differential tropism in the lung as compared to that with SARS-MA15 and attenuation of full-length SHC014-CoV in HAE cultures relative to SARS-CoV Urbani suggest that factors beyond ACE2 binding—including spike processivity, receptor bio-availability or antagonism of the host immune responses—may contribute to emergence. However, further testing in nonhuman primates is required to translate these finding into pathogenic potential in humans. Importantly, the failure of available therapeutics defines a critical need for further study and for the development of treatments. With this knowledge, surveillance programs, diagnostic reagents and effective treatments can be produced that are protective against the emergence of group 2b–specific CoVs, such as SHC014, and these can be applied to other CoV branches that maintain similarly heterogeneous pools.
In addition to offering preparation against future emerging viruses, this approach must be considered in the context of the US government–mandated pause on gain-of-function (GOF) studies22. On the basis of previous models of emergence (Fig. 4a,b), the creation of chimeric viruses such as SHC014-MA15 was not expected to increase pathogenicity. Although SHC014-MA15 is attenuated relative to its parental mouse-adapted SARS-CoV, similar studies examining the pathogenicity of CoVs with the wild-type Urbani spike within the MA15 backbone showed no weight loss in mice and reduced viral replication23. Thus, relative to the Urbani spike–MA15 CoV, SHC014-MA15 shows a gain in pathogenesis (Fig. 1). On the basis of these findings, scientific review panels may deem similar studies building chimeric viruses based on circulating strains too risky to pursue, as increased pathogenicity in mammalian models cannot be excluded. Coupled with restrictions on mouse-adapted strains and the development of monoclonal antibodies using escape mutants, research into CoV emergence and therapeutic efficacy may be severely limited moving forward. Together, these data and restrictions represent a crossroads of GOF research concerns; the potential to prepare for and mitigate future outbreaks must be weighed against the risk of creating more dangerous pathogens. In developing policies moving forward, it is important to consider the value of the data generated by these studies and whether these types of chimeric virus studies warrant further investigation versus the inherent risks involved.
Overall, our approach has used metagenomics data to identify a potential threat posed by the circulating bat SARS-like CoV SHC014. Because of the ability of chimeric SHC014 viruses to replicate in human airway cultures, cause pathogenesis in vivo and escape current therapeutics, there is a need for both surveillance and improved therapeutics against circulating SARS-like viruses. Our approach also unlocks the use of metagenomics data to predict viral emergence and to apply this knowledge in preparing to treat future emerging virus infections.
Methods
Viruses, cells, in vitro infection and plaque assays.
Wild-type SARS-CoV (Urbani), mouse-adapted SARS-CoV (MA15) and chimeric SARS-like CoVs were cultured on Vero E6 cells (obtained from United States Army Medical Research Institute of Infectious Diseases), grown in Dulbecco's modified Eagle's medium (DMEM) (Gibco, CA) and 5% fetal clone serum (FCS) (Hyclone, South Logan, UT) along with antibiotic/antimycotic (Gibco, Carlsbad, CA). DBT cells (Baric laboratory, source unknown) expressing ACE2 orthologs have been previously described for both human and civet; bat Ace2 sequence was based on that from Rhinolophus leschenaulti, and DBT cells expressing bat Ace2 were established as described previously8. Pseudotyping experiments were similar to those using an HIV-based pseudovirus, prepared as previously described10, and examined on HeLa cells (Wuhan Institute of Virology) that expressed ACE2 orthologs. HeLa cells were grown in minimal essential medium (MEM) (Gibco, CA) supplemented with 10% FCS (Gibco, CA) as previously described24. Growth curves in Vero E6, DBT, Calu-3 2B4 and primary human airway epithelial cells were performed as previously described8,25. None of the working cell line stocks were authenticated or tested for mycoplasma recently, although the original seed stocks used to create the working stocks are free from contamination. Human lungs for HAE cultures were procured under University of North Carolina at Chapel Hill Institutional Review Board–approved protocols. HAE cultures represent highly differentiated human airway epithelium containing ciliated and non-ciliated epithelial cells as well as goblet cells. The cultures are also grown on an air-liquid interface for several weeks before use, as previously described26. Briefly, cells were washed with PBS and inoculated with virus or mock-diluted in PBS for 40 min at 37 °C. After inoculation, cells were washed three times and fresh medium was added to signify time '0'. Three or more biological replicates were harvested at each described time point. No blinding was used in any sample collections nor were samples randomized. All virus cultivation was performed in a biosafety level (BSL) 3 laboratory with redundant fans in the biosafety cabinets, as described previously by our group2. All personnel wore powered air purifying respirators (Breathe Easy, 3M) with Tyvek suits, aprons and booties and were double-gloved.
Sequence clustering and structural modeling.
The full-length genomic sequences and the amino acid sequences of the S1 domains of the spike of representative CoVs were downloaded from Genbank or Pathosystems Resource Integration Center (PATRIC), aligned with ClustalX and phylogenetically compared by using maximum likelihood estimation using 100 bootstraps or by using the PhyML (https://code.google.com/p/phyml/) package, respectively. The tree was generated using maximum likelihood with the PhyML package. The scale bar represents nucleotide substitutions. Only nodes with bootstrap support above 70% are labeled. The tree shows that CoVs are divided into three distinct phylogenetic groups defined as α-CoVs, β-CoVs and γ-CoVs. Classical subgroup clusters are marked as 2a, 2b, 2c and 2d for β-CoVs, and 1a and 1b for the α-CoVs. Structural models were generated using Modeller (Max Planck Institute Bioinformatics Toolkit) to generate homology models for SHC014 and Rs3367 of the SARS RBD in complex with ACE2 based on crystal structure 2AJF (Protein Data Bank). Homology models were visualized and manipulated in MacPyMol (version 1.3).
Construction of SARS-like chimeric viruses.
Both wild-type and chimeric viruses were derived from either SARS-CoV Urbani or the corresponding mouse-adapted (SARS-CoV MA15) infectious clone (ic) as previously described27. Plasmids containing spike sequences for SHC014 were extracted by restriction digest and ligated into the E and F plasmid of the MA15 infectious clone. The clone was designed and purchased from Bio Basic as six contiguous cDNAs using published sequences flanked by unique class II restriction endonuclease sites (BglI). Thereafter, plasmids containing wild-type, chimeric SARS-CoV and SHC014-CoV genome fragments were amplified, excised, ligated and purified. In vitro transcription reactions were then preformed to synthesize full-length genomic RNA, which was transfected into Vero E6 cells as previously described2. The medium from transfected cells was harvested and served as seed stocks for subsequent experiments. Chimeric and full-length viruses were confirmed by sequence analysis before use in these studies. Synthetic construction of chimeric mutant and full-length SHC014-CoV was approved by the University of North Carolina Institutional Biosafety Committee and the Dual Use Research of Concern committee.
Mice and in vivo infection.
Female, 10-week-old and 12-month-old BALB/cAnNHsD mice were ordered from Harlan Laboratories. Mouse infections were done as previously described20. Briefly, animals were brought into a BSL3 laboratory and allowed to acclimate for 1 week before infection. For infection and live-attenuated virus vaccination, mice were anesthetized with a mixture of ketamine and xylazine and infected intranasally, when challenged, with 50 μl of phosphate-buffered saline (PBS) or diluted virus with three or four mice per time point, per infection group per dose as described in the figure legends. For individual mice, notations for infection including failure to inhale the entire dose, bubbling of inoculum from the nose, or infection through the mouth may have led to exclusion of mouse data at the discretion of the researcher; post-infection, no other pre-established exclusion or inclusion criteria are defined. No blinding was used in any animal experiments, and animals were not randomized. For vaccination, young and aged mice were vaccinated by footpad injection with a 20-μl volume of either 0.2 μg of double-inactivated SARS-CoV vaccine with alum or mock PBS; mice were then boosted with the same regimen 22 d later and challenged 21 d thereafter. For all groups, as per protocol, animals were monitored daily for clinical signs of disease (hunching, ruffled fur and reduced activity) for the duration of the experiment. Weight loss was monitored daily for the first 7 d, after which weight monitoring continued until the animals recovered to their initial starting weight or displayed weight gain continuously for 3 d. All mice that lost greater than 20% of their starting body weight were ground-fed and further monitored multiple times per day as long as they were under the 20% cutoff. Mice that lost greater than 30% of their starting body weight were immediately sacrificed as per protocol. Any mouse deemed to be moribund or unlikely to recover was also humanely sacrificed at the discretion of the researcher. Euthanasia was performed using an isoflurane overdose and death was confirmed by cervical dislocation. All mouse studies were performed at the University of North Carolina (Animal Welfare Assurance #A3410-01) using protocols approved by the UNC Institutional Animal Care and Use Committee (IACUC).
Histological analysis.
The left lung was removed and submerged in 10% buffered formalin (Fisher) without inflation for 1 week. Tissues were embedded in paraffin and 5-μm sections were prepared by the UNC Lineberger Comprehensive Cancer Center histopathology core facility. To determine the extent of antigen staining, sections were stained for viral antigen using a commercially available polyclonal SARS-CoV anti-nucleocapsid antibody (Imgenex) and scored in a blinded manner by for staining of the airway and parenchyma as previously described20. Images were captured using an Olympus BX41 microscope with an Olympus DP71 camera.
Virus neutralization assays.
Plaque reduction neutralization titer assays were performed with previously characterized antibodies against SARS-CoV, as previously described11,12,13. Briefly, neutralizing antibodies or serum was serially diluted twofold and incubated with 100 p.f.u. of the different infectious clone SARS-CoV strains for 1 h at 37 °C. The virus and antibodies were then added to a 6-well plate with 5 × 105 Vero E6 cells/well with multiple replicates (n ≥ 2). After a 1-h incubation at 37 °C, cells were overlaid with 3 ml of 0.8% agarose in medium. Plates were incubated for 2 d at 37 °C, stained with neutral red for 3 h and plaques were counted. The percentage of plaque reduction was calculated as (1 − (no. of plaques with antibody/no. of plaques without antibody)) × 100.
Statistical analysis.
All experiments were conducted contrasting two experimental groups (either two viruses, or vaccinated and unvaccinated cohorts). Therefore, significant differences in viral titer and histology scoring were determined by a two-tailed Student's t-test at individual time points. Data was normally distributed in each group being compared and had similar variance.
Biosafety and biosecurity.
Reported studies were initiated after the University of North Carolina Institutional Biosafety Committee approved the experimental protocol (Project Title: Generating infectious clones of bat SARS-like CoVs; Lab Safety Plan ID: 20145741; Schedule G ID: 12279). These studies were initiated before the US Government Deliberative Process Research Funding Pause on Selected Gain-of-Function Research Involving Influenza, MERS and SARS Viruses (PHE. This paper has been reviewed by the funding agency, the NIH. Continuation of these studies was requested, and this has been approved by the NIH.
SARS-CoV is a select agent. All work for these studies was performed with approved standard operating procedures (SOPs) and safety conditions for SARS-CoV, MERs-CoV and other related CoVs. Our institutional CoV BSL3 facilities have been designed to conform to the safety requirements that are recommended in the Biosafety in Microbiological and Biomedical Laboratories (BMBL), the US Department of Health and Human Services, the Public Health Service, the Centers for Disease Control (CDC) and the NIH. Laboratory safety plans were submitted to, and the facility has been approved for use by, the UNC Department of Environmental Health and Safety (EHS) and the CDC. Electronic card access is required for entry into the facility. All workers have been trained by EHS to safely use powered air purifying respirators (PAPRs), and appropriate work habits in a BSL3 facility and active medical surveillance plans are in place. Our CoV BSL3 facilities contain redundant fans, emergency power to fans and biological safety cabinets and freezers, and our facilities can accommodate SealSafe mouse racks. Materials classified as BSL3 agents consist of SARS-CoV, bat CoV precursor strains, MERS-CoV and mutants derived from these pathogens. Within the BSL3 facilities, experimentation with infectious virus is performed in a certified Class II Biosafety Cabinet (BSC). All members of the staff wear scrubs, Tyvek suits and aprons, PAPRs and shoe covers, and their hands are double-gloved. BSL3 users are subject to a medical surveillance plan monitored by the University Employee Occupational Health Clinic (UEOHC), which includes a yearly physical, annual influenza vaccination and mandatory reporting of any symptoms associated with CoV infection during periods when working in the BSL3. All BSL3 users are trained in exposure management and reporting protocols, are prepared to self-quarantine and have been trained for safe delivery to a local infectious disease management department in an emergency situation. All potential exposure events are reported and investigated by EHS and UEOHC, with reports filed to both the CDC and the NIH.
Accession codes
Accessions
Protein Data Bank
2AJF
Change history
30 March 2020Editors’ note, March 2020: We are aware that this article is being used as the basis for unverified theories that the novel coronavirus causing COVID-19 was engineered. There is no evidence that this is true; scientists believe that an animal is the most likely source of the coronavirus.
20 November 2015In the version of this article initially published online, the authors omitted to acknowledge a funding source, USAID-EPT-PREDICT funding from EcoHealth Alliance, to Z.-L.S. The error has been corrected for the print, PDF and HTML versions of this article.
xxxxxxxxxxxxxxxxxx
If we compare these numbers to a real pandemic like the 50 million dead worldwide of the Spanish Flu, we must ask WHAT'S ALL THE FUSS? The fuss only makes sense as a PSYOP.
"Viewed in it's totality this CV-1984 PSYOP is weaponized DISINFORMATION mainly targeting the Chinese-Russian-Iranian alliance overseas and Middle Class Americans at home."
Andrew is a retired attorney living in Texas.
by Andrew
(henrymakow.com)
Since the coronavirus outbreak began in China last December 2019, it's become a psychological warfare operation (PSYOP) with news outlets spreading sensational panic instead of reporting objectively and accurately.
Psychological operations are MILITARY operations to convey selected information to audiences to influence their emotions, motives, and objective reasoning, and ultimately their behavior and that of governments.
Remember this coronavirus is a chest cold virus and NOT an influenza virus with pandemic potential like the 1919 Spanish Flu which killed 50 Million people worldwide.
Supposedly this COVID-19 (CV 1984) is a first of its kind KILLER COLD. That's according to Dr. Anthony Fauci who daily announces PANDEMIC prophesies regarding this KILLER COLD.
scam.jpg
As of now, this KILLER COLD has SUPPOSEDLY infected ONLY 1,088,000 people globally and killed about 58,000. While these figures may not be particularly alarming compared to the 1919 Spanish Flu (a real pandemic), they are presented everyday as a doomsday prophesy by more-than-willing news outlets that scaremonger rather than report objectively.
As of Saturday April 4, 2020, Italy is reporting the most CV-19 deaths with almost 15,000 followed by Spain with 11,000, USA with 7000, France with 6500, China with 3400, Iran with 3300, etc. If we compare these numbers to a real pandemic like the 50 million dead worldwide of the Spanish Flu, we must ask WHAT'S ALL THE FUSS? The fuss only makes sense as a PSYOP. Actually this KILLER COLD (coronavirus) death toll is only relatively high in Italy, Spain, USA, France, China and Iran BUT not in countries like Syria (2), Russia (34), Mexico (50), India (72), Brazil (359), Sweden (373), etc.
Scott Bennett, a former psy-ops specialist with the US army, says, "this is a fabricated psychological operation that has been coordinated with an actual physical sickness (Dr Anthony Fauci's KILLER COLD) to spread fear, panic and intimidation in the Chinese economic markets with the purpose of isolating China and disrupting the Chinese-Russian-Iranian economic, military alliance...."
"This is an exploited psychological operation designed to sow panic, intimidation and also open up doors for 'aid and immune vaccination development,' which may in fact lead to more harm than good. Remember the West and its (US) Deep State are inundated with these big pharmaceutical companies that generate vaccines that do nothing except cause more harm..." he added.
"So the coronavirus I think, is developing into a lot of smoke but with no fire and the amount of people who die from traditional influenza and sicknesses actually exceeds the coronavirus explanations," he noted.
HIGHWAY ROBBERY
Bennett is right about the external targets of this CV-1984 PSYOP, but he failed to see or mention the targets inside America like the Middle Class American people, their retirement accounts and the US Economy.
jewish-trojan-horse.jpg
By convincing the American public that a common cold was the terrible PANDEMIC CV-19, Americans don't see their retirement accounts being drained by the FED working in cahoots with investment bankers on Wall Street like Goldman Sachs.
To make sure Americans don't connect the dots between the drainage of their retirement accounts to the FED and the investment bankers, the government imposes a nationwide quarantine to simultaneously destroy the American economy.
Controlled news outlets will convince everyone that a KILLER COLD and AND RESULTING quarantine impoverished them and not the FED and the stock market manipulating investment bankers...
Viewed in it's totality this CV-1984 PSYOP is weaponized DISINFORMATION mainly targeting the Chinese-Russian-Iranian alliance overseas and Middle Class Americans at home.
In this connection, we have to view Italy's CV-19 deaths with almost 15,000 supposed deaths in the context of events in March 2019 when Italy has become the first developed EU economy to sign China's Silk Road global investment program which has raised ALARM among Italy's American and EU allies.
"China's Communications and Construction Company will be given access to the port of Trieste to enable links to central and eastern Europe. The Chinese will also be involved in developing the port of Genoa." With Italian ports, China will enjoy perfect logistics to distribute their MADE IN CHINA products throughout the EU.
BBC
We should therefore end the quarantines, go back to work and school to revitalize the US and World economies.
Then we need to END THE FED and prosecute the bankers and investment bankers for restitution and CRIMINAL LIABILITY UNDER RICO for their fraudulent financial conspiracy. We need to get mad and get our money back from crooks on Wall Street and the FED who need to join Bernie Madoff in Federal Prison. And a few other things....
------------
Related - A more detailed treatment of this theme
-------Makow - It's 9-11 all over again, except it's us trapped on 94th floor
---------------------------- Pandemic Masks Communist Power Grab
----------------------------Scamdemic is another live drill
Note-
CV 1984 is just a cold NOT A FLU and therefore has NO PANDEMIC POTENTIAL. "The human coronavirus (HCoV) contains HCoV-229E, HCoV-NL63, HCoV-OC43, HCoV- HKU1, SARS-CoV and MERS-CoV. HCoV-229E, HCoV-NL63, HCoV-OC43 and HCoV-HKU1 are pathogens of COMMON COLD." SARS, MERS and coronavirus infections. - PubMed - NCBI
NCBI
First Comment from Scott-
sars.jpg
Henry, this has a least one precedent. A virus was used as a psy-op. In the States, SARS was treated like "if you breathe the air in Canada, you're gonna DIE!" Network news programs would edit to images of Chinese walking around in surgical masks.
At the time, it seemed like economic warfare against Canada. This was due to Jean Chretien's refusal to send troops to Iraq in 2003. The tactic worked. Tourism was way down.
What put an end to it? The Rolling Stones concert, outside of Toronto. Even the most fearful could see that all was safe!
xxxxxxxxxxxxxxxxxxxx
Google has launched a website which uses anonymized location data to show where people are taking social distancing more seriously than others.
Collected from their various products and services, the COVID-19 Community Mobility Reports site will show changes in behavior – such as shopping and recreation, from a top-down look at entire countries – to individual states.
The website will track changes over several weeks – for time periods as recent as 48-to-72 hours prior, and will include 131 countries and certain counties within several states.
Google says the data will be collected in aggregate, rather than at an individual level, and it won’t show absolute numbers of people showing up at parks or grocery stores. The idea instead is to outline percentages, which highlight potential surges in attendance. For example, its first reports states that San Francisco County has seen a 72% drop in retail and recreation, a 55% decline in parks’ population, and a 21% increase in residential population between Feb. 16 and March 29. –CNBC
[below data since updated]
According to the report, public health departments may find this data useful in detecting the next potential coronavirus hotspot when used in conjunction with data collected at the local, state and federal level such as symptoms patients are reporting in emergency rooms. It may also help officials to target residents of certain areas with messaging about social distancing.
“This information could help officials understand changes in essential trips that can shape recommendations on business hours or inform delivery service offerings,” reads Google’s announcement.
That said, the project is bound to raise privacy concerns. While the new site says that it uses anonymized information from people’s “location history” setting in Google Maps and other services – which the company says is “turned off by default,” their location tracking has been the subject of controversy in the past.
April 2019, CNBC’s Todd Haselton found that Google had been tracking his location for years without him realizing it, and explained how to turn tracking off. In October 2019, Australian officials accused Google of misleading consumers in 2018 and earlier about the settings necessary to turn off location tracking. – CNBC
Meanwhile, Google’s parent company, Alphabet, has been trying to work with government officials during the pandemic. Their life-sciences subsidiary, Verily, has already partnered with the Trump administration for a screening and testing website.
xxxxxxxxxxxxxxx
Chinese foreign ministry spokesman pushes coronavirus conspiracy theory that the US Army 'brought the epidemic to Wuhan'
Ryan Pickrell Mar 14, 2020, 7:18 AM
china military flag
China's flag is raised during the opening ceremony of the 2008 Beijing Olympic Games. Jerry Lampe/Reuters
A Chinese government spokesman said on Thursday that the US Army might have "brought the epidemic to Wuhan," fueling a coronavirus conspiracy theory.
Chinese officials have been trying to reshape the narrative about the coronavirus, suggesting that it might have originated outside of China, even though the center of the outbreak was the central Chinese city of Wuhan.
Amid this push, a conspiracy theory that US athletes participating in the Military World Games in Wuhan last fall brought the coronavirus into China has emerged. There is no evidence supporting this claim.
A Chinese government spokesman said on Thursday that the US Army may have "brought the epidemic to Wuhan," fueling a coronavirus conspiracy theory.
Zhao Lijian, a spokesman for China's Ministry of Foreign Affairs, called attention to a comment on Wednesday from Robert Redfield, the director of the US Centers for Disease Control and Prevention, acknowledging that some Americans who were said to have died from influenza may have actually died from COVID-19.
"When did patient zero begin in US? How many people are infected?" Zhao wrote on Twitter. "What are the names of the hospitals? It might be US Army who brought the epidemic to Wuhan. Be transparent! Make public your data! US owe us an explanation!"
In a short thread on Twitter — a social media platform that's inaccessible in China — Zhao demanded to know how many of the millions of infections and thousands of deaths during the latest flu season were actually related to COVID-19.
The US State Department summoned Chinese Ambassador to the US Cui Tiankai Friday to protest the spokesman's comments, Reuters reported, and the Pentagon sharply criticized Zhao's remarks, calling them "false and absurd."
Alyssa Farah
✔
@PentagonPresSec
As a global crisis, COVID-19 shd be an area of cooperation between nations. Instead, the Communist Party of China has chosen to promulgate false & absurd conspiracy theories about the origin of COVID-19 blaming U.S. service members. #ChinaPropaganda
Lijian Zhao 赵立坚
✔
@zlj517
2/2 CDC was caught on the spot. When did patient zero begin in US? How many people are infected? What are the names of the hospitals? It might be US army who brought the epidemic to Wuhan. Be transparent! Make public your data! US owe us an explanation!
Embedded video
206
6:34 PM - Mar 13, 2020
Twitter Ads info and privacy
149 people are talking about this
The coronavirus first appeared in the central Chinese city of Wuhan late last year, and since then, the pandemic has claimed the lives of thousands of people, mostly in China.
As China has faced criticism, Chinese authorities have pushed back, suggesting that the virus may have originated somewhere else. Dr. Zhong Nanshan, a leading Chinese epidemiologist, said in late February that "though the COVID-19 was first discovered in China, it does not mean that it originated from China."
Zhao stressed the same point in a recent press briefing.
"No conclusion has been reached yet on the origin of the virus," he told reporters, adding that "what we are experiencing now is a global phenomenon with its source still undetermined."
One popular coronavirus conspiracy theory that has emerged in China is that US military athletes participating in the Military World Games in Wuhan last year may have brought the virus into China. There is, however, no evidence to support this accusation.
The Trump administration has laid the blame firmly at China's feet. "Unfortunately, rather than using best practices, this outbreak in Wuhan was covered up," the White House national security adviser, Robert O'Brien, told reporters on Wednesday.
"It probably cost the world community two months to respond," he added.
Geng Shuang, another Chinese foreign ministry spokesman, said O'Brien's "immoral and irresponsible" comments denigrated China's efforts to fight the virus. He added that the US should focus on "international cooperation instead of trying to shift the blame."
Update: This post has been updated to include the State Department and Pentagon's reaction to Zhao Lijian's comments
xxxxxxxxxxxxxxxxxx
VICE
China is pushing the unfounded conspiracy theory that the virus was created by the U.S. military and brought to China by an army athlete.
By David Gilbert
Mar 26 2020, 7:36amShareTweetSnap
AP PHOTO/ANDY WONG
A Chinese state-run newspaper is pushing an unfounded conspiracy theory that a U.S. military athlete was the patient zero of coronavirus.
The Global Times, citing known U.S. conspiracy theorist George Webb, claims that the virus was manufactured in a U.S. military lab and brought to China by a cyclist who took part in the World Military Games in Wuhan in October.
The claim is part of a wider effort by the Chinese government to change the narrative about the origin of the coronavirus, as the Trump administration continues to label the pandemic as the “Chinese virus” or the “Wuhan virus.”
The conspiracy theory linking the outbreak to the U.S. athletes’ visit to the games in Wuhan was first promoted by foreign ministry spokesman Zhao Lijian, who tweeted about it earlier this month. It was then repeated by other officials and by state-run news outlets.
It appeared that Beijing was standing down from its conspiracy push earlier this week, when China's ambassador to the U.S. Cui Tiankai dismissed the conspiracy theory as “crazy” in an interview with Axios.
But on Wednesday, Beijing doubled down by publishing the claims first put forward by Webb.
The Global Times admits that Webb’s conclusions are “without strong evidence”, but it also claims that Chinese citizens and experts are calling on the U.S. to publish details about the athletes who traveled to Wuhan.
Among those cited is Li Haidong, a professor of U.S. studies at the China Foreign Affairs University in Beijing. The Global Times quotes him saying that Washington needs to publish the “relevant information regarding the athlete’s health status and infection records to clear public doubts and help with the scientific study on the virus' origin.”
READ: Beijing is pushing a conspiracy theory that the US Army brought the coronavirus to China
The theory was repeated in several other Chinese-language outlets and was also shared by WeChat users.
As China tries to refocus attention away from Wuhan and onto the U.S., the Trump administration appears unwilling to back down from using what many deem racist language about the coronavirus.
Donald Trump on Wednesday said he was going to stop using the term “Chinese virus,” telling Fox News that “we shouldn't make any more of a big deal out of it.” Trump said he only began using it because of the conspiracy theories being shared by Chinese officials.
But his Secretary of State Mike Pompeo is continuing to push the use of these problematic terms.
Pompeo held a virtual conference with leaders from the G7 alliance on Wednesday but they were unable to agree on a joint statement on the global pandemic. The reason, according to sources speaking to ABC News, was that Pompeo insisted that any statement include the term "Wuhan virus.”
China initially suppressed news of the outbreak, silencing whistleblower doctors and other citizens seeking to share information from Wuhan during the peak of the outbreak. And yet, while the World Health Organization has acknowledged China made some “mistakes” in its initial handling of the outbreak, WHO officials have been largely positive about how Beijing has responded to the crisis.
READ: China is trying to rewrite the history of silenced coronavirus whistleblower doctor Li Wenliang
But the U.S. continues to lay the blame for the global pandemic, which has now killed over 21,000 people, on Beijing’s mishandling of the crisis accusing it of “blatant and dangerous propaganda” about the disease’s origins.
“First [China] tried to suppress the news. Then, it worked to protect its own population while selectively sharing critical information, such as genetic sequence data, and continuing to stonewall international health authorities that were offering assistance, requesting access and seeking more information,” wrote Woody Johnson, U.S. ambassador to the U.K., in an opinion piece in the London Times on Thursday.
“Had China done the right things at the right time, more of its own population, and the rest of the world, might have been spared the most serious impact of this disease.”
Cover: Chinese Foreign Ministry new spokesman Zhao Lijian gestures as he speaks during a daily briefing at the Ministry of Foreign Affairs office in Beijing, Monday, Feb. 24, 2020. (AP Photo/Andy Wong
xxxxxxxxxxxxxxxxxxxx
Breaking: US Athlete/Intelligence Officer in China Games named as Patient Zero for COVID, debunking Trump Rhetoric (updating)
By Jim W. Dean, Managing Editor -March 26, 20201113048
US urged to release health info of military athletes who came to Wuhan in October 2019
https://www.globaltimes.cn/content/1183658.shtml
[ Editor’s Note: China’s Global Times (below) today released the name of Staff Sgt Maatje Benassi, a professional cyclist (woman/Dutch heritage) who participated in the Wuhan games and has, according to the Global Times, tested positive for COVID 19.
Watch an American appear to purposefully spread COVID in Wuhan.
Rosemary
@RosemaryLxiao
In October, the US military went to Wuhan for the World Military Games. 😡👇
She is also described as an “armed diplomatic driver” with a history of ties to intelligence operations involving key RussiaGate figures.
Benassi was driver for General James Jones, of ShadowNet, (George Webb) and worked for US Army intelligence. ShadowNet and Psy-Group along with Cambridge Analytica were part of the Mueller investigation, seeking information on their relationships with Paul Manafort (imprisoned) and Donald Trump Jr. (not yet imprisoned).
Other claims, from Russia, say that 67 in the US military have died as of a week ago, but this is from a medical/diplomatic source in Moscow and is without confirmation.
China is asking the US to release information on how many US military who left Wuhan (369 were there) have tested positive. Note that many could have been infected on the plane returning from China… Jim W. Dean ]
Jim's work includes research, field trips, Heritage TV Legacy archiving & more. Thanks for helping. Click to donate >>
Serbia’s bare bones facility for mild virus cases
– First published … March 25, 2020 –
Chinese netizens and experts urge the US authority to release health and infection information of the US military delegation which came to Wuhan for the Military World Games in October to end the conjecture about US military personnel bringing COVID-19 to China.
An American journalist claimed one US military athlete in the delegation could be patient zero of the deadly new disease.
George Webb, an investigative journalist in Washington, DC claimed in recent videos and tweets that he believes Maatje Benassi, an armed diplomatic driver and cyclist who was in Wuhan in October for the cycling competition in the Military World Games, could be patient zero of COVID-19 in Wuhan.
[According to] a report by the US Department of Defense official website on October 25, Maatje Benassi has participated 50-mile cycling road race in Wuhan.
Webb also quoted a military lab, the Fort Detrick laboratory that handles high-level disease-causing organisms such as Ebola, in Fredrick, Maryland, which was shut down and moved in July due to unqualified facilities and management system.
TruthLeaks - Investigative Journalist George Webb
@GeorgWebb
Patient Zero from Wuhan, Maatje Benassi, is a Dutch American woman cyclist. Her husband is also a cyclist in the US Atmed Forces (SPAWAR) and believe you be in Wahan in October of 2019. Benny Benassi is Patrient Zero in Holland, and has already made a rap video about Coronavirus
View image on TwitterView image on TwitterView image on TwitterView image on Twitter
751
7:05 AM - Mar 22, 2020
Twitter Ads info and privacy
551 people are talking about this
His conclusions, although without strong evidence, triggered questions on Chinese social media as it came only days after a petition was submitted to the White House website on March 10 listing some coincidences in time between the Fort Detrick lab’s closure and the COVID-19 outbreak.
TruthLeaks - Investigative Journalist George Webb
@GeorgWebb
March 23rd, 2020. Origins of CoronaVirus - Metadata Says Ft. Detrick Youtu.be
Many Chinese netizens have urged the US to test Benassi for COVID-19 and release information on the US delegation.
Li Haidong, a professor of US studies at the China Foreign Affairs University in Beijing, told the Global Times on Tuesday that the US government needs to respond to the controversy and publish the relevant information regarding their health status and infection record to clear public doubts and help with the scientific study on the virus’ origin.
TruthLeaks - Investigative Journalist George Webb
· Mar 20, 2020
Interesting Coronavirus Patient One n the US is Dutch and shares the same last name as Patient One in Holland, and they are both celebrities. Maatje Benissa is an Intel Officer at Ft Belvoir, VA as well. Her brother Matt is SpaWar.
View image on TwitterView image on TwitterView image on TwitterView image on Twitter
TruthLeaks - Investigative Journalist George Webb
@GeorgWebb
Interesting her relative in Holland also has CoronaVirus. DancingAstronaut …
Benny Benassi stuck in Italy due to nationwide quarantine, cancels upcoming North American tour
Benny Benassi is stuck at home this season.
dancingastronaut.com
171
5:07 AM - Mar 20, 2020
Twitter Ads info and privacy
138 people are talking about this
US politicians have been contending the novel coronavirus is “Made in China,” while global scientists, including those in the US, have not found strong evidence to prove the virus’ origin. Given this situation, it is important to trace any suspicious points, the US delegation to the Wuhan games in this scenario, and find out what really happened, Li said.
COVID-19, a deadly disease caused by the novel coronavirus, has infected more than 330,000 people around the world and killed more than 14,000.
Identifying the origin will help develop effective therapy on the disease. The US should provide information of the delegation members to support related research, Li said.
Earlier in March, Zhao Lijian, an outspoken Chinese diplomat, raised a suspicion on his personal Twitter account that it might have been the US army representatives to the Military World Games who brought the novel coronavirus to Wuhan in October 2019, after a top US health official admitted detecting coronavirus infections on some deceased flu patients.
Zhao urged the US to disclose further information, exercise transparency on coronavirus cases and provide an explanation to the public.
US women finish 8th despite crash in 50-mile cycling road race
By Gary Sheftick, Army News ServiceOctober 24, 2019
WUHAN, China — A hit from behind on the final lap may have dashed the U.S. Armed Forces’ hopes for gold in women’s cycling, but bruised ribs and a cracked helmet didn’t stop Sgt. 1st Class Maatje Benassi from crossing the finish line.
Benassi led the pack for much of the third and fourth laps in the 50-mile, five-lap road race Sunday during the second day of cycling competition in the CISM Military World Games. She had dropped back to draft a while and was just beginning her final push when the crash happened.
“My plan was to move up on the left,” Benassi said. Two more wide right turns were approaching before the finish “and so if you move on the left, you don’t have to hit your brakes; you can carry all that momentum — that speed — going into the turn.”
CISM, or the International Military Sports Council, holds the games every four years, with more than 100 nations participating in 32 sports. The council is referred to by its French acronym, CISM, because French is its founding language.
As the pack approached the 2-kilometer mark from the finish, “there was a lot of movement going on,” she said. “It got really sketchy.”
When she went full speed into the right turn, she spotted a white jersey come up from behind. That competitor’s front tire hit her back wheel, taking her down.
Her head hit the ground and she heard a click “and I knew I broke the helmet at that point,” she said. “My first reaction was, ‘I couldn’t breathe.'” The impact literally knocked the wind out of her. “I just had to catch my breath, but it wouldn’t come.”
Army
MAATJE BENASSI // CYCLING
Motto: “Just be better”
Sergeant First Class Maatje Benassi, an Army Reserves Motor Transport Operator, was one of the founding members of the U.S. Military Cycling Team (U.S. Military Cycling Team later became USMES). Maatje began riding 22 years ago, competing in legendary races like Redlands and the HP Women’s Challenge, which led to a pro career racing on the Veritas Professional Women’s Team. In 2008 Maatje enlisted in the Army and put bike racing on hold. “I joined USMES just prior to a deployment and learned how caring the team and the sponsors were while I was downrange in Iraq — I learned what it was like to be part of a cycling family,” said Maatje. After leaving active duty Maatje began training again in 2018. Older and wiser but not slower, Maatje completed her first full “comeback” season in 2019 as a Category 1 on the road, track and cyclocross, returning to represent the U.S. Armed Forces for the third time at the CISM Military World Games. In 2020 Maatje will be competing in races on the regional MABRA (Mid-Atlantic Bicycle Racing Association) calendar, and hopes to nab more national and world titles at the U.S. Masters Nationals Road Cycling Championships, U.S. Masters Nationals Track Cycling Championships, and the Masters Worlds Track Cycling Championships.
After 40+ wins as a Pro/1/2 and four masters national championship titles, Maatje shares her favorite racing moment: “I always remember a small hill climb in Golden Colorado that I won three years back-to-back. Short and steep with a mass start, it suited my strengths. I always liked ramping up the pace and seeing my competitors drop away one by one until I crossed the line solo.”
We look forward to seeing that climbing magic at the 2020 USMES Tucson Camp, where Maatje will be sharing her tactical and training knowledge with her up-and-coming teammates. When she isn’t racing, Maatje has organized the Colorado Springs USMES bicycle giveaway to needy children at Fort Carson. She’s also worked with her husband to promote cycling events in California and Colorado including several USMES National Events, stage races, road races, a track series, a local MTB series and two UCI MTB races
xxxxxxxxxxxxxxxxx
CoronaVirus BioWeapon – 7. NWO-CIA-DEM Top Secret Military Missions in Ukraine, Fort Detrick, Sigonella, Wuhan, Modena
Fabio Giuseppe Carlo Carisio 24 Marzo 2020 3
CoronaVirus BioWeapon – 7. NWO-CIA-DEM Top Secret Military Missions in Ukraine, Fort Detrick, Sigonella, Wuhan, Modena
x
FacebookTwitterWhatsAppEmailLinkedInShare
11.132 Views
Pentagon centers for bacteriological warfare
in Georgia and Ukraine after the colored coups
North American’s research on CoronaVirus in 2007
Mysterious accidents in Fort Detrick’s biochemical activity
Suspects on US troops in Wuhan for the 2019 Games
Cremations hushed by Army in Emilia without any autopsy
by Fabio Giuseppe Carlo Carisio
VERSIONE ORIGINALE IN ITALIANO
It is disturbing to discover that all the most important research on bacteriological weapons financed and coordinated by the Pentagon have developed above all in two countries, Georgia and Ukraine, which have become a colony of the USA thanks to the colored revolutions which the Open Society’s financier George Soros took all credit for.
CORONAVIRUS – 10. The Plot in 100 lines: from CIA Bio-Weapons to New World Order Prophecy
This happened precisely in the years when the “queen” of the intelligence of the Dems, Avril Haines, was working at the top of the Central Intelligence Agency and of the National Security of the White House, before predicting, with exceptional prophetic talents, the pandemic for pathogen infectious, during a conference in 2018 and then during the suspected exercise on the simulated emergency for CoronaVirus on October 2019 in New York.
CoronaVirus BioWeapon – 6. Prophecy on Pandemic and NWO by Obama-Biden CIA’s Queen
These searches were carried out (but continue because certain Pentagon’s mechanisms once set in motion proceed almost autonomously) in the republic of Kiev especially after the coup openly supported and financed by Washington during the Government of the former Democratic President Barack Obama and his deputy Joe Biden, ended up in the sights for the shady affairs of his son Hunter, implicated together with the “pupil” of the Secretary of State John Kerry in the most important Ukrainian energy company Burisma with licenses for extraction of gas and oil in Donbass, the Russian-speaking region since 2014 cut down from an almost forgotten Civil War.
Pandemic Bio-Weapon – 9. Supervirus Created by US during Obama’s Govt: 89 CoVid Strains in CIA’s Top Secret Tests
As we have highlighted in previous reports Obama was also the proponent of the immunization pilot plan “imposed” on Italy by the Global Health Security Agenda (GHSA), with the vaccines of the British GlaxoSmithKline, participated by the American investment funds of the Weapons’ Lobby and by Bill Gates, first prophet of the pandemic in 2015.
The 10 mandatory vaccines project was implemented in 2017 (Lorenzin Decree) by former Italian Prime Minister Paolo Gentiloni, ally of Soros and today European Commissioner, in accordance with the wishes of the Democratic Party.
UE: 3 COMMISSARI E 73 DEPUTATI NELLA SOROS LIST. MOLTI PRO “NO GENDER”
It should be remembered that the PD government was born with Matteo Renzi who, by another arcane coincidence, became premier with the blessing of the former US president on February 22, 2014, exactly the same day on which Viktor Ianukovich, Russian-freindly president of Ukraine, legitimately elected, he was forced to flee from the coup in the warp square even with sniper shots on the crowd that caused 104 deaths.
This happened with a shootout similar to that attributed to a clandestine CIA operation in Caracas in 2002, when the president of the Bolivarian Republic of Venezuela Hugo Chavez was later arrested by the American special wards, later released with the mediation of the local cardinal for the massive counter-revolution of the population loyal to him.
DONBASS: STRAGE PER IL GAS
Among the victims of the massacre in Maidan square in Ukraine of 20 February 2014 there were 87 demonstrators but also 17 policemen demonstrating that the mysterious assassins were certainly not of the government police, as instead claimed by the revolutionaries.
During the protests the rioters were piloted by CANVAS (the Belgrade center of the closed fist Otpor created by the CIA in Belgrade during the Balkan war) who on their official website openly boast of that coup as well as that in Georgia (Roses’ Revolution, 2003). As ascertained by an Italian war reporter, some of those snipers were actually of Georgian nationality…
HONG KONG: US-CANVAS MOLOTOV’ PACIFISTS: campus and subway burning, man set on fire, lawmaker stabbed
There are indeed more and more coincidences that would horrify Leroy Jethro Gibbs, the legendary federal agent of the successful TV series NCIS (Naval Criminal Investigative Service) for which “coincidences do not exist”.
What does all this have to do with SARS-Cov-2 Severe Acute Respiratory Syndrome as the current pandemic was renamed which in Italy reached a mortality of 8% bringing the dead to over 5,400 in the last few hours?
Firstly, it highlights that the so-called Deep International State, the hidden Masonic, financial, political and military entity, recently unveiled and “lauded” by a former CIA director of Dem extraction, does not pose any major problems to cause “human collateral damage” to pursue its geopolitical goals.
Secondly, perhaps we will never know …
Because a latest military operation conducted with maximum secrecy protocols is erasing the traces of any possible connection between the bacteriological research developed by “contractors” of the Pentagon, headquarters of the Department of Defense in Washington, and the violent pandemic that broke out in Italy…
TOP SECRET CREMATIONS IN ITALY
The latest mysterious operations are the mass cremations of the CoVid-19 deaths managed by the Italian Army for the emergency situation in Lombardy and especially in Bergamo, without first carrying out those autopsies necessary to reveal the viral genomic identity.
In Wuhan, scientists carried out necropsies on some of the deceased and discovered two genotypes of the CoronaVirus: the “S” of intense morbidity but very low mortality and the “L” very aggressive, with very high infectivity and lethality, resulting in a “reshaping” of the previous caused from human intervention: according to the hypothesis of doctors for the consequent therapies, according to those of intelligence analysts for a previous “modeling”.
The abstract from the article published in the National Science Review
Scientific investigations should focus on this primary “track” but all Italian doctors, 4,000 of whom have been infected, are too busy facing the challenges with overcrowded hospitals of people positive for CoVid-19 and therefore the sample autopsies conducted so far are a number infinitesimal and insignificant. While in the Defense sector…
«Mouths sewn» is the only comment that a civil protection operator on the field today, a former military officer with long experience of missions abroad and trained for emergencies from NBCR (Nuclear Bacteriological Chemical and Radiological) attacks, adds after reporting the indiscretion that in the crematoriums there would even be “group cremations”. Since it is not allowed to ask questions to the Commissioner for Emergency during the daily press conferences of the Civil Protection in Rome, this and other doubts remain open.
Up to now two military columns have left the province of Bergamo, escorted by the Carabinieri with a dozen trucks to carry out a first transport of 60 coffins on March 18 to the crematorium of Modena and another of 70 on March 21 to that of Ferrara. Other subsequent trips with the dead to be cremated were made in Piedmont to the Serravalle Scrivia, Trecate and Domodossola plants. Obviously the relatives of the victims were prevented from seeing them and celebrating the funeral rites for the emergency decrees on the risk of infection.
«In Lombardy there are many factors that contribute to these data: the average age, the population density- We must see this virus as an opportunist: before declaring the dead, it is important to do an autopsy and be able to say what died the patient» higlighted virologist Maria Rita Gismondo, but, as said, doctors and health facilities are just enough to deal with the emergencies of the living who come to the Emergency Department often already in the Yellow Code for severe respiratory failure.
PRIVATE CONTRACTORS AT CIA SERVICE IN GEORGIA
But we see in a rapid journey all the suspicious military missions among which the search and diffusion of the increasingly probable bio-weapon could nest. To do this, we take up again the investigation of the Bulgarian journalist Dilyana Gaytandzhieva, the one who discovered the weapons delivered by the CIA to the ISIS of their friend Al Baghdadi, which we mentioned in our first report of February 4 in reference to bio-genetic bacteriological weapons, or rather able to target a specific ethnic group in a more virulent way than another: just as it is happening in Italy and Iran …
Journalist Dilyana Gaytandzhieva who discovered the CIA arms trade for ISIS terrorists
«US bio-laboratories are funded by the Defense Threat Reduction Agency (DTRA) under a $ 2.1 billion military program– Cooperative Biological Engagement Program (CBEP), and are located in former Soviet Union countries such as Georgia and Ukraine, the Middle East, South East Asia and Africa» journalist reported pointing out at least 25 research centers that, instead, according to Russian intelligence would instead be at least a hundred.
Among the first to end up under the lens of all the media in the world, it was the most famous: the Pentagon Lugar Center in Georgia. It is located just 17 km from the US military air base Vaziani in the capital Tbilisi. Included in the military program are biologists from the US Army Medical Research Unit-Georgia (USAMRU-G) together with private contractors. The level 3 bio-safety laboratory is only accessible to US citizens with a safety authorization. They are granted diplomatic immunity.
CoronaVirus – 1. “IT’S BIO-WEAPON”. Us Expert blames China but forgets 25 Pentagon’s Secret Labs for “Ethnic Attacks”
We spoke in two previous reports of this and the DoD’s Defense for Threats Reduction Agency (DTRA) which represents the ingenious “diaphragm” between the Pentagon, a government subject subject to national and international laws, and the “contractors”, or private companies that based on privacy on industrial patents and constraints on military secrecy can operate beyond any political control. Among the American companies that have been working at Lugar for years, the best known are three: CH2M Hill, Metabiota and Battelle.
«In addition to the Pentagon, these private contractors perform biological research for the CIA and various other government agencies» added the Bulgarian reporter also referring to the DARPA (Defense Advanced Research Projects Agency) which in 2014 launched a specific sector of experimentation on bacteriological weapons called Biological Technologies Office (BTO), within which the project “Insect Allies“ was developed, officially to exploit them, through genetic bioengineering modifications, in the fight against agricultural pests, but not only: according to some experts.
The Pentagon has invested at least $65 million in gene editing. The DARPA has awarded 7 research teams to develop tools for genome engineering in insects, rodents and bacteria under DARPA’s Safe Gene program, using a novel CRISPR-Cas9 technology.
«However, a group of well-respected, independent scientists revealed in a scathing analysis of the program that, far from a “defensive” research project, the Insect Allies program was aimed at creating and delivering “new class of biological weapon.” The scientists, writing in the journal Science and led by Richard Guy Reeves, from the Max Planck Institute for Evolutionary Biology in Germany, warned that DARPA’s program — which uses insects as the vehicle for as horizontal environmental genetic alteration agents (HEGAAS) — revealed “an intention to develop a means of delivery of HEGAAs for offensive purposes (emphasis added)» specified the American counter-information site UNZ.
We will analyze above all the activity of Battelle because it is involved in a CIA project and indirectly involved in a very suspicious incident which occurred on a US military base last July.
MISTERIOUS BIO-SAFETY ACCIDENTS IN FORT DETRICK
«Battelle as a $59 million subcontractor at Lugar Center has extensive experience in research on bio-agents, as the company has already worked on the US Bio-weapons Program under 11 previous contracts with the US Army (1952-1966)» Gaytandzhieva points out in 2018 dossier republished by Nature.
«The private company performs work for the Pentagon’s DTRA bio laboratories in Afghanistan, Armenia, Georgia, Uganda, Tanzania, Iraq, Afghanistan and Vietnam. Battelle conducts research, development, testing, and evaluation using both highly toxic chemicals and highly pathogenic biological agents for a wide range of US government agencies. It has been awarded some $2 billion federal contracts in total and ranks 23 on the Top 100 US government contractors list».
Battelle Memorial Institute from 1997 to 2000 started the Clear Vision Project together with the CIA to rebuild and test a Soviet-era anthrax projectile and verify the possible spread of this and other bio-agents by bombers..
«The clandestine CIA-Battelle operation was omitted from the US Biological Weapons Convention declarations submitted to the UN» supports the report.
Battelle has operated a Top Secret Bio laboratory (National Biodefense Analysis and Countermeasures Center – NBACC) at Fort Detrick, Maryland under a US Department of Homeland Security (DHS) contract for the last decade. The company has been awarded a $344.4 million federal contract (2006 – 2016) and another $17.3 million contract (2015 -2026) by DHS.
This is precisely the time when the “CIA prophetess” of the current pandemic, Avil Haines, was deputy White House National Security Advisor. And it is precisely here that the first surprise following the Bulgarian journalist’s investigation arrives.
United States Army Medical Research Institute of Infectious Diseases in Fort Detrick (Maryland)
«It is also important to point out the fact that the U.S. military’s key laboratories involving the study of deadly pathogens, including coronaviruses, Ebola and others, was suddenly shut down last July after the Center for Disease Control and Prevention (CDC) identified major “biosafety lapses” at the facility» we read in a recent UNZ article about a circumstance reported by many other media including Veterans Today in recent days.
«The U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID) facility at Fort Detrick, Maryland — the U.S. military’s lead laboratory for “biological defense” research since the late 1960s — was forced to halt all research it was conducting with a series of deadly pathogens after the CDC found that it lacked “sufficient systems in place to decontaminate wastewater” from its highest-security labs and failure of staff to follow safety procedures, among other lapses. The facility contains both level 3 and level 4 biosafety labs. While it is unknown if experiments involving coronaviruses were ongoing at the time, USAMRIID has recently been involved in research borne out of the Pentagon’s recent concern about the use of bats as bioweapons».
It should not be forgotten that the bat (together with the mongoose) was suspected by scientists of being the carrier of SARS-CoV-2 from animals to humans, obviously before Chinese chemists discovered the existence not only of the strange protein “S modeled” but also the double genotype of the virus…
«The decision to shut down USAMRIID garnered surprisingly little media coverage, as did the CDC’s surprising decision to allow the troubled facility to “partially resume” research late last November even though the facility was and is still not at “full operational capability.” The USAMRIID’s problematic record of safety at such facilities is of particular concern in light of the recent coronavirus outbreak in China. As this report will soon reveal, this is because USAMRIID has a decades-old and close partnership with the University of Wuhan’s Institute of Medical Virology» outbreak of the first epidemic explosion, which now seems almost totally overcome in the country.
CIA-PENTAGON RESEARCHES ON CORONAVIRUS
The correlations between the two countries are more than you might imagine: among them there was a study conducted by the Beijing Ministry of Science which led to the discovery of 89 bat CoronaVirus strains in collaboration with the USAID agency (the government agency for aid to developing countries which often finances political movements for regime change as happened in Syria and Venezuela) the CIA, the Pentagon and the Institute of Health and Human Services in Washington.
GUAIDO’: L’OBAMA SBIANCATO AGENTE USA A CARACAS
An Arab Facebook user recently posted a video in French that went viral (and later blocked by FB) raising suspicions about a European patent from the Pasteur National Research Center of the Diderot University of Paris concerning a “new strain of CoronaVirus associated with Sars” filed as early as 2004. But the controversy was unfounded because it referred to research for the vaccine on the first SARS that hit China and other countries in 2003 but “only” 814 deaths against the more than 15 thousand of the current SARS 2 pandemic.
Research patents of the US Government and Gsk and the initial one of the Pasteur Institute of Paris spread over the first type of Sars
However, it is important to note that among the first to develop those studies also aimed at new “applications” were the US Department of Health (HHS) filing an American registration and the usual giant of the GlaxoSmithKline vaccines. The European patent was curiously “reactivated” on March 20, 2020, probably in the context of research against CoVid-19.
Title page of the patent registered by the US Department of Health in 2007 (pdf file available on request by email)
It is still the Bulgarian reporter who recalls that «Numerous studies have been performed under the DTRA Cooperative Biological Engagement Program (CBEP) in a search for deadly pathogens of military importance in bats».
One of these is precisely that on the large viral strain of CoronaVirus, which includes simple flu but also SARS and its “cousin” MERS, the Middle Eastern Acute Repiratory Syndrome which in June 2017 killed 699 and infected 1,980 people in 15 countries.
«MERS-CoV is one of the viruses that have been engineered by the US and studied by the Pentagon, as well as Influenza and SARS. Confirmation of this practice is Obama’s 2014 temporary ban on government funding for such “dual-use” research. The moratorium was lifted in 2017 and experiments have continued. Enhanced Potential Pandemic Pathogens (PPPs) experiments are legal in the US» reporter points out in reference to the Statute of The International Criminal Court (ICC) in Rome which instead forbids them in article 8 but has never been signed by the North American government.
Exactly in 2015, however, a new study on the Corona Virus, officially to prevent avian bronchitis in chickens, was started by the Pirbright Institute in the United Kingdom and then registered in 2018 with a U.S. patent, as specified in the first Gospa News report on epidemic.
Well, among the funders of the research center there is once again the Bill & Melinda Gates Foundation, sponsor of the Dems and Obama, but above all of the research on the new CoVid-19 vaccine of the Australian Queensland University in collaboration with the usual GSK.
CoronaVirus BIO-ARMA – 3. VACCINO D’ORO GSK. Big Pharma partner di Bill Gates, Pentagono e Lobby Sionista Usa
There would be much to write about the suspicious episodes between the US and China, including two arrests which, however, did not lead to ascertaining with certainty the purposes of the illegal actions. As Veterans Today recalled on January 28, Professor Charles Lieber, president of the Harvard Department of Chemical Biology, is arrested for leading a Chinese research team focused on using nanotechnology to identify viruses.
In December 2019, a Chinese medical researcher, Zheng Zaosong, of the Beth Israel Deaconess Medical Center, was instead stopped by the FBI special agent Kara Spice who found him in possession of 21 ampoules containing a “brown liquid” that seemed to be ” biological material “taken from a Boston laboratory. His research friend admitted that other comrades had managed to bring samples to China: it is not known whether for biogenetic studies on American samples or if by sabotage.
US NAVY BIOLOGISTS IN SIGONELLA BEFORE THE EPIDEMIC
In the same month, however, something even more sensational occurred between Egypt and Italy when the Naval Medical Resarch Unit, called NAMRU 3, was transferred from the historic Cairo base where it operated since 1946 at the Naval Air Station of Sigonella, believed to be the main military station of the CIA not only in Sicily but throughout Italy.
NAMRU3 is the US Navy department that conducts research and experiments on viral or bacterial pathogens that can infect American troops. But according to an article of 27 January 2012 in the Egyptian newspaper Al-Wafd it would be a small laboratory of horrors …
«When you pass next to the large NAMRU headquarters located in the Al-Abbasia district, in the heart of Cairo with its gate reinforced with iron and concrete, the wide space of flat land that surrounds it, the security cameras and the high walls that protect it, one cannot fail to suspect the great importance of what is inside this building. Unit researchers and American doctors enjoy diplomatic immunity. In fact, some of them belong to the CIA» wrote the Arab newspaper.
«Since the founding of the NAMRU unit in Egypt, dozens of new and changed viral diseases have been discovered. This may lead to suspicion that these pathogens are imported. No medical research institute has infiltrated Egypt to a greater extent than NAMRU, which controls the secrets of viruses used in mass destruction and biological weapons»
In confirmation of this, Al-Wafd recalls that Ethiopia had decided to close the NAMRU unit on its territory, due to accusations and suspicions about its activity, which instead had been expanded in Egypt following an agreement with the Health Ministry and with the Hospital of the Fevers of Abbassia.
CoronaVirus BioWeapon – 5. Cardinal Blames: “A Rich Country Sowed This Poison. UN must Investigate”
«Already in 1976, the Egyptian public became aware of the name NAMRU on the occasion of an outbreak of meningitis in Egypt». The US Navy Medical Research Unit offered to collaborate with Abbassia Hospital but the studies on the victims remained top secret because 50 of the 857 infected died right after the intervention of the American doctors with the administration of a medicine that caused side effects. Were human guinea pigs unaware?
«In 2006 the NAMRU sparked another scandal, which subsided with suspicious rapidity. An American delegation from NAMRU visited the headquarters of Al-‘Abbasia hospital, and bird flu was discovered several days later [in Egypt]. Egyptian doctors were able to eliminate [the disease] almost completely within six months, but then Maher Abaza [a powerful oligarch handcuffed with Mubarak – ed.) Was appointed agriculture minister and decided, without reason to suspend the involvement of the Egypt to manage the virus in exchange for a contract with NAMRU-3. Later, the Egyptians were hit by an untreatable mutant of the avian flu virus. This mutant virus appeared after NAMRU received [blood] samples from Egyptian patients, who were sent to the United States».
On July 2019, the command of the Naval Medical Research Unit No. 3 (NAMRU-3) stationed in Cairo (Egypt) from the Second World War took office in the large Sicilian air and naval base by temporarily occupying building no. 318, pending the start of the renovation and expansion of Building No. 303 to NAS 1 (the oldest station in Sigonella, for US use only). The move was completed in December and the unit became operational in February.
Naval Air Station of Sigonella at the “Cosimo Di Palma” airport of the Italian Air Force in Lentini (Syracuse)
«To date it is not possible to know if and when the sudden move was authorized by the executive and why Parliament was not informed despite the political-strategic and “scientific” relevance of the US unit, directly dependent on the Naval Medical Research Center of US Navy and Marine Corps, based in Silver Spring, Maryland» blogger Antonio Mazzeo rightly alarmed.
The US Air Force Global Hawk RQ-4 giant drones have also been deployed in the same location. The attention of the Veterans Today site has focused on them which reported the disturbing indiscretion from foreign intelligence sources that the biological attack in Italy would have been made more lethal than elsewhere for an interaction of the virus with a nerve chemical agent, the terrible Sarin gas, used in microdoses so as not to make it detectable.
We report this information for completeness of information even if NBCR medical experts operating in emergency rooms in Italian hospitals to deal with the epidemic have not detected similar symptoms on patients and have confirmed that at the moment, in the MaxiEmergency stage, only the bacteriological health protocol.
SUSPICIOUS MASSACRE OF MILITARY IN UKRAINE
But let’s go back to Ukraine in the years following the Orange Revolution coup promoted by Soros, the main financier of the media propaganda of November 2013 together with the US and UK embassies but also of the Democratic Party for which he has already subscribed for a super contribution of 5.1 million dollars in the Political Action Committee (PAC) even before knowing who will be the candidate to win the primaries.
UkraineGate: islamic reporter funded by Obama-Biden and Soros in 2014 coup, now at the top of weapon’s industry
At the moment the race sees Joe Biden as his favorite, known for the direct management of military and public security funding to Ukraine and repeatedly called into question by various dossiers in the context of the impeachment against the current President Donald Trump on the UkraineGate for which the former CIA director thanked the Deep State.
«Among the set of bilateral agreements between the US and Ukraine is the establishment of the Science and Technology Center in Ukraine (STCU) – an International organization funded mainly by the US government which has been accorded diplomatic status. The STCU officially supports projects of scientists previously involved in the Soviet biological weapons program. Over the past 20 years the STCU has invested over $285 million in funding and managing some 1,850 projects of scientists who previously worked on the development of weapons of mass destruction» highlighted Bulagarian reporter.
UKRAINEGATE: an investigative “memo” accuses Joe Biden and John Kerry too. Reopened the inquiry
«One of the Pentagon laboratories is located in Kharkiv, where in January 2016 at least 20 Ukrainian soldiers died from Flu-like virus in just two days with 200 more being hospitalized. The Ukrainian government did not report on the dead Ukrainian soldiers in Kharkiv. As of March 2016 364 deaths have been reported across Ukraine (81.3 % caused by Swine Flu A (H1N1) pdm09 – the same strain which caused the world pandemic in 2009). According to DPR intelligence information the US bio lab in Kharkiv leaked the deadly virus. Police investigate infection with incurable disease».
A highly suspicious Hepatitis A infection spread rapidly in just few months across South East Ukraine where most of the Pentagon biolabs are located.
The list of viral infections could continue with cases of cholera (2011, 2014 and 2015) and hepatitis A (2017). While a strange epidemic of Congo-Crimean Crimean Hemorrhagic Fever (CCHFV) appeared in Afghanistan after the launch of the Cooperative Biological Commitment Program (CBEP) of the DTRA agency with various contractors connected to the Lugar Center of Georgia.
CIA Middle East chief, Soleimani Killer and Bin Laden Hunter, dead on Jet in Afghanistan. Tasnim & Mirror told after VT & Gospa News
Coincidences such as the one for which an American spy plane, the Northrop Grumman E-11A Bomber, crashed in the region of Gazni, in which would also have died the CIA commander in the Middle East, Mike D’Andrea, nicknamed Dark Prince, a few weeks before the CoVid-19 pandemic spread to Iran after spreading to China.
Afghanistan: Pentagon Confirmed Dead Airmen’s Identity. Pilot worked for Intelligence CIA
The conditional on the death of Langley’s counterintelligence officer remains as the Pentagon only confirmed the death of the two pilots, one of whom was certainly CIA operative, but denied the existence of a crew as if the surveillance aircraft had none despite sophisticated electronic machinery to manage …
MILITARY GAMES IN WUHAN: IDEAL FOR CIA NANO-DRONES
But the coincidences are starting to be too many. Like the one already mentioned in the previous article on the Wuhan World Military Games in which an American delegation took part in October 2019, while the former CIA deputy director Avril Haines in New York participated in the simulated exercise on the pandemic by CoronaVirus funded and prophesied in the 2015 by Bill Gates.
CoronaVirus BioWeapon – 4. PANDEMIC! As Predicted in Bill Gates forum (video) with ex-CIA. Italy and Iran Massacred in Bio-Warfare for their A.I. Deal
«The American team did so badly that they were called “Soy Sauce Soldiers” by the Chinese. In fact, many never attended any events and remained close to the Huanan seafood wholesale market, where the disease was said to have originated only a few days after the United States left the area» Veterans Today wrote that it was a fake team.
The American military team returned home on October 28, 2019 and, within 2 weeks (just the viral incubation period), the first cases of human contact with COVID 19 were ascertained in Wuhan. The Chinese were unable to find patient zero and they therefore suspected that it was an American military officer officially asking the US for information on their first infection.
But if you want to give credit to the theory of the virus spread with nano-drones by CIA agents undercover, reported in the previous article on the basis of intelligence information, it is clear that the concept of the “patient” zero is overcome by an artificial spread that could have been implemented in large area with the 10 cm UAV Black Hornet 3 already widely used in NATO armies as a spy vehicle or with DragonflEye, the cyber-dragonflies genetically modified and remotely controlled with light which can also carry micro-cameras or small payloads such as viral micro-capsules. Or be the same “allied insects” of the Pentagon’s research of pathogenic germs…
CoronaVirus BioWeapon – 2. Intel sources: «Spread by CIA with nano-Uav» as Cyber-DragonflEye. Alert in Iran and Italy
It doesn’t have to look like science fiction because these nano-drones are projects that the CIA had been studying since the distant 1970 and the very small size of the kits can easily fit in a shoes box, without infections risk of virus managing: they are therefore very easy to hide especially when a sports delegation arrives in a foreign country…
If the hypothetical dispersion of the bacteriological weapon in Iran can be explained by the American operations in Afghanistan, also confirmed by the shooting down of the plane deemed the flying command of the Central Intelligence Agency, that in Italy does not even need technical explanations since the secret agents of the US counter-intelligence have total freedom of movement and the military departments can even transfer a sophisticated unit of biological doctors and scientific researchers from Africa to Sicily without the Italian Parliament even discussing it.
UKRAINEGATE, CIA-DEEP STATE’S PLOT AGAINST TRUMP with two whistleblowers and Italian ties
The clues of a coordinated military action by biological warfare with the DEEP STATE and CIA, wich have been traveling hand in hand for the same admission of its leaders as at the time of the P2-Gladio-Stay Behind operation, are now macroscopic. According to Veterans Today, the Israeli counter-intelligence of the infamous Mossad of Tel Aviv, a fundamental partner of the geopolitical strategies of the Zionists in the field of war and weapons, could have played a role in the conspiracy.
LOBBY ARMI – 3: TYCOON SIONISTA DEI DRONI SPIA-KILLER PREMIATO DAI MASSONI USA E DALLA REGINA UK
This would also explain the haste and secrecy with which the corpsens of Italian victims are cremated without lingering on autopsies: the only potential evidence of any bio-genetic viral weapons.
What remains to be ascertained is whether Republican President Donald Trump, today in great difficulty in view of the elections due to the emergency that caused over 200 deaths in the US, or his predecessor, was aware of this hypothetical devilish plan even more permeated by the spectrum of the New World Order. And, in case, even if their equivalent in Rome had been made aware of it …
Fabio Giuseppe Carlo Carisio
© COPYRIGHT GOSPA NEWS
no reproduction without authorization
xxxxxxxxxx
The conspiracy linking 5G to coronavirus just will not die
Harmeet Kaur
By Harmeet Kaur, CNN
Updated 3:32 PM ET, Wed April 8, 2020
Telecommunications workers are seen working on a mobile cell tower in Sydney on Wednesday, March 25.
Telecommunications workers are seen working on a mobile cell tower in Sydney on Wednesday, March 25.
(CNN)As the spread of the coronavirus is proving difficult to contain, so too is the misinformation surrounding it.
One of the most recent, baseless conspiracy theories surrounding the virus is that 5G networks -- the next generation of wireless technology that's steadily being rolled out around the world -- are fueling the global coronavirus pandemic. They are not.
Unfounded claims about a supposed link between 5G and Covid-19 began circulating on the fringes of the internet, where New Agers and QAnon followers perpetuated the hoax that global elites were using 5G to spread the virus. Unsophisticated algorithms amplified those voices and ushered unsubstantiated theories into the mainstream.
Officials in the United Kingdom have expressed concerns that recent attacks on cell phone towers were motivated by false conspiracy theories. Meanwhile, actor Woody Harrelson and singer M.I.A. are among celebrities and influencers spreading such claims to their millions of followers.
There's no evidence to support the theory that 5G networks cause Covid-19 or contribute to its spread. But still, it refuses to die.
Here's what to know about 5G networks, how these false theories came about and why they don't hold up.
How 5G works
There are several theories linking 5G and Covid-19. One simply suggests that 5G networks cause Covid-19, or symptoms of the infection. Another more insidious one is that 5G networks emit radiation that weakens the immune system, making people more susceptible to infection.
To break it down, it helps to understand what exactly 5G is.
The big differences between 4G and 5G
The big differences between 4G and 5G
5G is a next-generation wireless network that is expected to enable a wave of technologies that will change the way that people live and work -- the potential applications include self-driving cars, remote surgeries and automated factories, though it will be a while before we see those kinds of changes.
The big differences between 4G and 5G are faster speeds, higher bandwidth and lower lag time in communications between devices and servers.
5G signals run over new radio frequencies, which requires updating radios and other equipment on cell towers. Carriers building superfast 5G networks have to install tons of small cell sites to light poles, walls or towers, often in close proximity to each other. So far, the networks have mostly been deployed city by city.
Why people are linking 5G and Covid-19
5G networks began rolling out in cities and countries in 2018, but were more widely adopted in 2019 -- the same year that Wuhan, China, saw the world's first coronavirus outbreak.
Conspiracy theorists were quick to link the two, ignoring the ever-relevant adage: Correlation does not imply causation.
People on the internet shared two maps of the United States suggesting areas that had been hit hardest by Covid-19 were also places where 5G networks had been installed.
Another thing those areas have in common? They're metropolitan areas: large population centers that are more vulnerable to the spread of the coronavirus and are more likely to adopt 5G networks earlier.
There are other reasons those suggestions don't hold up. Although Iran has not rolled out 5G, it's one of the countries hardest hit by the pandemic.
Upgrades to wireless infrastructure have been falsely linked to diseases before, and the same has happened this time around with the coronavirus.
Many of the 5G/Covid-19 conspiracy theories are linked to groups that have long claimed that wireless airwaves cause cancer, though there is no credible evidence to support this.
Research shows that radiofrequency (RF) waves given off by cell phones do not have enough energy to damage DNA directly or heat body tissues -- their energy levels are lower even than technologies such as microwave ovens and televisions. What's more, 5G signals are actually worse at penetrating objects than 4G signals, which is why 5G networks require many more, smaller cell sites built close together.
What's being done to limit the spread
Social media and internet platforms have started taking steps to limit the spread of coronavirus misinformation, though some have been slow to act.
YouTube videos that drew connections between 5G networks and the coronavirus have racked up hundreds of thousands of views. But the company initially said such videos were not in direct violation of its policies before moving to ban them Tuesday.
YouTube tries to limit spread of false 5G coronavirus claims after cellphone towers attacked
YouTube tries to limit spread of false 5G coronavirus claims after cellphone towers attacked
Twitter said it was increasing its use of machine learning and automation to help take down false information. A quick search for "5G coronavirus" Wednesday mostly showed tweets from people casting doubt on conspiracy theories and links from news organizations in the "Top" results, despite turning up several false theories days earlier.
"We will continue to take action on accounts that violate our rules, including content in relation to unverifiable claims which incite social unrest, widespread panic or large-scale disorder," a spokesperson for the company said. "If people see anything suspicious on our service, please report it to us."
Similarly, a Facebook search for "5G coronavirus" yielded mostly reliable information from news organizations, hospitals and health organizations, though false theories can still be found through the platform.
A spokesperson for Facebook said the company is taking "aggressive" measures to combat misinformation surrounding the virus, and is "starting to remove false claims which link Covid-19 to 5G technology" and which encourage attacks on cellular towers.
CNN's Brian Fung, Clare Duffy and Hadas Gold contributed to this report..
xxxxxxxxxxxx
Logistical and Technical Exploration into the Origins of the Wuhan Strain of Coronavirus (2019-nCoV)
FEB 17, 2020OPINION
YouTube summary of the report below by a Professor of Neurobiology at UPitt is available here.
https://youtu.be/WT3Ypg9LOWU
2/14, 3:02am EST: A probable smoking pre-print has been released, by the Natural National Science Foundation of China:
“In summary, somebody was entangled with the evolution of 2019-nCoV coronavirus. In addition to origins of natural recombination and intermediate host, the killer coronavirus probably originated from a laboratory in Wuhan.”
And in a predictable turn, both researchers have since deleted their profiles off of the ResearchGate site completely. Additionally, the trend in reporting from the Chinese government diverged sharply on February 11th, when the paper initially was uploaded onto the site – making it appear as there’s internal infighting within the Party about what their official story will be.
This report is the product of a collaboration between a retired professional scientist with 30 years of experience in genomic sequencing and analysis who helped design several ubiquitous bioinformatic software tools, and a former NSA counterterrorism analyst. It considers whether the Wuhan Strain of coronavirus (2019-nCoV) is the result of naturally emergent mutations against the possibility that it may be a bio-engineered strain meant for defensive immunotherapy protocols that was released into the public, most likely by accident since China’s rate of occupational accidents is about ten-times higher than America’s, and some twenty-times more than Europe’s – the only other regions with high-level virology labs.
This mistake may have been precipitated by the need to quickly finish research that was being rushed for John Hopkin’s Event 201 which was held this past October and meant to gameplan the containment of a global pandemic. Research may also have been hurried due to deadlines before the impending Chinese New Year – the timing of these events point to increased human error, not a globalist conspiracy. Beijing has had four known accidental leaks of the SARS virus in recent years, so there is absolutely no reason to assume that this strain of coronavirus from Wuhan didn’t accidentally leak out as well. This is unlikely to be a plot twist in one of the novels Tom Clancy wrote after he started mailing it in.
Simply and horribly, this is likely to become another Chernobyl or Fukushima – a catastrophic illustration of mankind’s hubris and intransigence clashing with Nature, as fate again reaps a once unimaginably tragic toll.
Given that this outbreak was said to begin in late December when most bat species in the region are hibernating and the Chinese horseshoe bat’s habitat covers an enormous swath of the region containing scores of cities and hundreds of millions people to begin with, the fact that this Wuhan Strain of coronavirus, denoted as 2019-nCoV, emerged in close proximity to the only BSL-4 virology lab in China, now notoriously located in Wuhan, which in turn was staffed with at least two Chinese scientists – Zhengli Shi and Xing-Yi Ge – both virologists who had previously worked at an American lab which already bio-engineered an incredibly virulent strain of bat coronavirus – the accidental release of a bio-engineered virus meant for defensive immunotherapy research from Wuhan’s virology lab cannot be automatically discounted, especially when the Wuhan Strain’s unnatural genomic signals are considered.
– In 2002, Stony Brook first assembled a virus from scratch, building a polio-virus, and providing proof-of-concept for the creation, alteration, and manipulation of viral genomes.
– By 2015, conducting research that was met with an enormous amount of concern, scientists at UNC had successfully created a “chimeric, SARS-like virus” by altering the viral genome of a Chinese bat coronavirus’s spike-protein genes – sequences that code for the spikes that poke out from surface of viruses and allow them to unlock entry into hosts, in this case making the bio-engineered coronavirus incredibly contagious. This research raised eyebrows since it was clearly gain-of-function research – experimentation that seeks to increase a pathogen’s virulence, creating a more effective double-edged sword to counter – a practice banned in America from 2014 until December 2017 when NIH lifted the ban, specifically to allow research on this sort of virus. Looking at UNC’s gain-of-function research on coronavirus spike-proteins, which received its funding just before the ban was implemented and was only allowed to go forward following a special review, a virologist with the Louis Pasteur Institute of Paris warned: “If the [new] virus escaped, nobody could predict the trajectory.”
– But then oddly, in late January right as the pandemic was blooming, Dr. Ralph Baric claimed in an interview that people should be more concerned with the seasonal flu – despite having personally overseen the controversial engineering of a hyper-virulent strain of batty coronavirus just a few years back. Immediately discounting the burgeoning outbreak of an unknown coronavirus as a non-event seems particularly troubling for someone who’d trained two Chinese scientists on how to make hyper-virulent coronaviruses, especially when it’s hard to imagine that Dr. Baric was unaware his past colleagues were now working at the Wuhan Virology Lab, the epicenter of the outbreak.
– Scientists have expressed concern about China’s ability to safely monitor this BSL-4 lab in Wuhan since it opened in 2017: “an open culture is important to keeping BSL-4 labs safe, and he questions how easy this will be in China, where society emphasizes hierarchy. ‘Diversity of viewpoint, flat structures where everyone feels free to speak up and openness of information are important.’” This lab is at most 20 miles from the wet market where the virus had been assumed to have jumped from animal to human. However the idea that a Chinese lab could have a viral sample escape is well-documented – as mentioned, one lab in Beijing has had four separate incidents of the SARS virus leaking out accidentally.
xxxxxxxxxxxxxxx
JamesFetzer
Crucial Facts About COVID-19: Transmissibility, Death Rates, and Raw Numbers
April 9, 2020 James Fetzerblog
James D. Agresti
James D. Agresti
While COVID-19 cases and deaths continue to surge, the upshot is that the number of people who are actively infected and contagious is far lower than the total of reported and undiagnosed cases.
Given the spread of misinformation about COVID-19, Just Facts is providing a trove of rigorously documented facts about this disease and its impacts. These include some vital facts that have been absent or misreported in much of the media’s coverage of this issue. This research also includes a groundbreaking study to determine the lethality of COVID-19 based on the most comprehensive available measure: the total years of life that it will rob from people.The US Centers for Disease Control and Prevention (CDC) emphasizes that “this is a rapidly evolving situation,” and as such, this article will be updated each weekday as the CDC publishes new data.On one hand, the facts show that:
The death rate for people who contract COVID-19 is uncertain but is probably closer to that of the seasonal flu than figures commonly reported by the press.
The average years of life lost from each COVID-19 death are significantly fewer than common causes of untimely death like accidents and suicides.
The virus that causes COVID-19 is “very vulnerable to antibody neutralization” and has limited ability to mutate, which means it is very unlikely to take lives year after year.
If 240,000 COVID-19 deaths ultimately occur in the United States, the virus will rob about 2.9 million years of life from all Americans who were alive at the outset of 2020, while accidents will rob them of about 409 million years—or about 140 times more than COVID-19.
Source Data)
On the other hand, elderly people and those with chronic ailments are extremely vulnerable to COVID-19. Furthermore, the disease is highly transmissible, which means it could spread like wildfire and overwhelm hospitals without extraordinary measures to contain it. This would greatly increase its death toll.
However, such precautionary measures often have economic and other impacts that can cost lives, and overreacting can ultimately kill more people than are saved.
Likelihood of Exposure
Per the US Centers for Disease Control and Prevention, a total of 330,891 people in the United States have been diagnosed with COVID-19 as of 1:00 PM EST April 7, 2020. The US population is 329 million people, which means that one out of every 994 people has been diagnosed with COVID-19. The disease is not equally dispersed throughout the nation, so this figure is much higher in some areas and much lower in others.
Reported cases don’t include people who may have COVID-19 but have not yet been diagnosed. Because its incubation period is 2–14 days, the number of people who have been infected could substantially exceed the number who have been diagnosed.
Also, the vast majority of people who contract COVID-19 experience only mild or no symptoms, and many of them may never be diagnosed. This means that the count of reported cases further understates the actual number of people who have been infected. A February 2020 study in the Journal of the American Medical Association based on data from China found that 81 percent of reported COVID-19 cases are “mild.” The true portion of such cases is even higher than this, for as the paper explains, there are “inherent difficulties in identifying and counting mild and asymptomatic cases.”
A rare case in which asymptomatic cases can be counted is the Diamond Princess cruise ship, since all passengers were tested for COVID-19. Among those who tested positive, 51 percent didn’t have symptoms when they were tested. The number of these people who later developed symptoms is currently unavailable.
Conversely, the number of people who have ever been infected may greatly exceed the number who are still infected. Growing numbers of people who were once diagnosed with COVID-19 have recovered, and the count of those who were unknowingly infected and had fast recoveries could be enormous. A March 2020 paper in the journal Microbes and Infection notes that “most infected individuals … appear to be able to recover with little to no medical intervention.”
Moreover, a March 2020 paper in the Pediatric Infectious Disease Journal states:
Preliminary evidence suggests children are just as likely as adults” to contract Covid-19, but they are “less likely to be symptomatic,” and even those with diagnosed infections typically “recover 1–2 weeks after the onset of symptoms.
The upshot of all this is that the number of people who are actively infected and contagious is lower than the total of reported and undiagnosed cases.
A March 2020 paper in the journal Science condenses the factors above into a single number. It estimates that 86 percent of all COVID-19 infections in Wuhan, China “were undocumented” before the government implemented travel restrictions. This means that the number of people who were infected was six times the number of documented infections. This figure declines as social distancing measures are adopted and as diagnoses and recoveries rise as time passes.
Under that worst-case scenario from Wuhan, if the number of people with contagious COVID-19 infections in the US is actually six times the number of people who have been diagnosed with it, the average American would have to come in contact with 295 people to be exposed to one person who has it.
To watch “The Raw Deal” (8 April 2020), click here.
Numbers of Deaths
A total of 11, 784 US residents have died from COVID-19 as of 1:00 PM EST April 7, 2020. To put this figure in perspective:
Roughly 12,469 people in the US died from the swine flu from April 12, 2009 to April 10, 2010. Unlike COVID-19, which mainly kills older people with preexisting health problems, 87 percent of people killed by the swine flu were under the age of 65.
An average of 37,000 people in the US have died from influenza (“the flu”) each year over the past nine years.
Around 170,000 people per year in the US die from accidents.
In other words, deaths from COVID-19 are now 1.7 percent of the annual fatalities from the flu and accidents. Although COVID-19 is a new disease and took its first reported life in the US during late February, this comparison may substantially overstate the relative deadliness of COVID-19 because fatalities from accidents and the flu occur in droves every year, and this is unlikely for COVID-19.
The primary reason why the flu takes tens of thousands of lives every year is because the viruses that cause it mutate in ways that prevent people from becoming immune to them. Per the Journal of Infectious Diseases, “All viruses mutate, but influenza remains highly unusual among infectious diseases” because it mutates very rapidly, and thus, “new vaccines are needed almost every year” to protect against it. While much remains to be seen about the mutations of the virus that causes COVID-19, the early indications are that it will not mutate rapidly and become an ongoing scourge.
As detailed in a March 2020 paper in a molecular biology journal that cites Michael Farzan, co‐chair of the Department of Immunology and Microbiology at Scripps Research, once a vaccine for COVID-19 is developed, it “would not need regular updates, unlike seasonal influenza vaccines” because the part of the virus that the vaccine targets “is protected against mutation” by a feature of its genetic material, or RNA.
The same point applies to naturally acquired immunity. People who get COVID-19 develop natural antibodies that protect against future infections of it. The physiology textbook The Human Body in Health and Illness explains that such immunity, which is called “active immunity,” is “generally long lasting.” The same applies to diseases like measles, mumps, rubella, and polio. If someone contracts these diseases, they rarely get them again, and furthermore, they are very unlikely to transmit them to others. Thus, these people become firewalls against the spread of these contagions.
Media outlets like The Atlantic, Vox, and Forbes have turned the truth of this matter on its head by confusing the general nature of coronaviruses with that of COVID-19. The habit of calling COVID-19 “the coronavirus” can be very misleading because there are different types of coronaviruses, and COVID-19 is caused by just one of them. Coronaviruses are a family of RNA viruses that includes some common cold viruses. These viruses tend to mutate rapidly, but COVID-19 does not share that trait. Per the same March 2020 paper cited just above, the virus that causes COVID-19 “does not mutate rapidly for an RNA virus because, unusually for this category, it has a proof‐reading function” in its genetics.
Likewise, a February 19th editorial in the British Medical Journal about COVID-19 reports that the “genome data available so far show no unexpected mutation rate or signs of adaptation….”
Put simply, COVID-19 does not mutate nearly as much as the flu, and thus, it is far less likely to take lives regardless of acquired immunity and vaccines. If this proves true in the long run, as current evidence suggests it will, the lifetime risk of dying from COVID-19 is greatly overstated by comparing its ultimate death toll to yearly fatalities from the flu, accidents, suicides, and other frequent causes of death.
Years of Lost Life
Beyond raw numbers of deaths, another crucial factor in measuring the deadliness of a public health threat is the ages of its victims. In the words of the CDC, “the allocation of health resources must consider not only the number of deaths by cause but also by age.” Hence, the “years of potential life lost” has “become a mainstay in the evaluation of the impact of injuries on public health.”
In this respect, COVID-19 is much less lethal than common causes of untimely death, such as accidents. The precise average age of death for COVID-19 fatalities is still unknown, but the vast majority of victims are elderly or have one or more chronic illnesses, as is the case with deaths from the flu and pneumonia.
Based on the CDC’s latest data for the age distribution of deaths, the average age of death for accidents is about 53.3 years, while for the flu and pneumonia, it is about 77.4 years. Using flu and pneumonia as a rough proxy for COVID-19, this disease robs an average of 12.0 years of life from each of its victims, as compared to 30.6 years of lost life for each accident. And again, accidents kill around 170,000 Americans per year, while COVID-19 is unlikely to have an ongoing high death toll because of its limited prospects for mutation.
In a March 29th comment that generated headlines in virtually every major media outlet, renowned immunologist Anthony Fauci told CNN’s Jake Tapper that “looking at what we’re seeing now, I would say between 100,000 and 200,000” Americans will die from COVID-19, but “I just don’t think that we really need to make a projection when it’s such a moving target that you can so easily be wrong and mislead people.” The next day, Dr. Fauci emphasized that those figures are based on a model, and “a model is as good as the assumptions that you put into” it.
A day later at a White House press conference, Dr. Deborah Birx, another world-renowned immunologist, presented a slide of model results based upon “five or six international and domestic modelers from Harvard, from Columbia, from Northeastern, from Imperial who helped us tremendously.” The model projects that 100,000 to 240,000 deaths will occur if Americans follow social distancing and hygiene guidelines. She added that “we really believe and hope every day that we can do a lot better than that because that’s not assuming 100% of every American does everything that they’re supposed to be doing, but I think that’s possible.”
If the high-end of that range comes to pass, and 240,000 US residents die from COVID-19, this disease will rob 2.9 million years of life from all Americans who were alive at the outset of 2020. In comparison, accidents will rob them of 409 million years.
These figures reveal that accidents are about 140 times more lethal to Americans than this worst-case scenario for COVID-19 given mitigation. This is a substantially more comprehensive measure of deadliness than the tally of lives lost during a year—or any other random unit of time—because it accounts for the entirety of people’s lives and the total years of life that are lost.
While not diminishing the value of any life, these facts speak to the efforts that society takes to save some lives versus others.
Death Rates
Initial media reports of a 2–3 percent mortality rate for COVID-19 are inflated, and the actual figure may be closer to that of the flu, which has averaged about 0.15 percent over the past nine years in the United States. A large degree of uncertainty surrounds this issue due to the same factor that prevents accurate counts of infections: unreported cases.
As explained by Dr. Brett Giroir—who has authored nearly 100 peer-reviewed scientific publications and serves as the Assistant Secretary for Health at the US Department of Health and Human Services—the COVID-19 death rate is “lower than you heard probably in many reports” because the bulk of people who contract coronavirus don’t get seriously ill, and thus, many of them never get tested.
Giroir calls this a “denominator problem” because if you’re “not very ill, as most people are not, they do not get tested. They do not get counted in the denominator.” Giroir’s best estimate is that the mortality rate is probably “somewhere between 0.1% and 1%.” This “is likely more severe in its mortality rate than the typical flu” rate of 0.1% to 0.15%, “but it’s certainly within the range.”
Giroir’s estimate accords with a February 2020 commentary in the New England Journal of Medicine by renowned immunologist Anthony Fauci and others:
If one assumes that the number of asymptomatic or minimally symptomatic cases is several times as high as the number of reported cases, the case fatality rate may be considerably less than 1%. This suggests that the overall clinical consequences of Covid-19 may ultimately be more akin to those of a severe seasonal influenza (which has a case fatality rate of approximately 0.1%) or a pandemic influenza (similar to those in 1957 and 1968) rather than a disease similar to SARS or MERS, which have had case fatality rates of 9 to 10% and 36%, respectively.
A prime example of how journalists misreport on this issue is a March 12th article in Business Insider by Andy Kiersz. In this piece, he compares the “death rates” of COVID-19 from the South Korean CDC to that of the flu from the United States CDC. Based on these numbers, he reports that “South Korea—which has reported some of the lowest coronavirus death rates of any country—still has a COVID-19 death rate more than eight times higher than that of the flu.”
What Kiersz and his editors fail to understand is that the denominator for the Korean rate is the number of “confirmed cases,” while the denominator for the US rate is based on a “mathematical model.” The CDC clarifies how the model works by citing a study on swine flu, which multiplies “43,677 laboratory-confirmed cases” of the disease by 41 to 131 times to calculate the denominator for the death rate. In the authors’ words, they do this because confirmed cases are:
likely a substantial underestimate of the true number. Correcting for under-ascertainment using a multiplier model, we estimate that 1.8 million–5.7 million cases occurred, including 9,000–21,000 hospitalizations.
Put simply, COVID-19 death rates that are based upon reported or confirmed infections grossly undercount the number of people with the disease. This, in turn, makes the death rate seem substantially higher than reality.
Social Media Amplification
The famous maxim that “there are six degrees of separation between everyone in the world” has changed in recent years due to social media. A 2014 paper in the journal Computers in Human Behavior finds that the “average number of acquaintances separating any two people” has declined from six to 3.9.
A 2011 paper in the American Journal of Sociology estimates that each American knows an average of 550 people. If 150 of these are mutual connections who already know each other, each American has about 220,000 friends of friends—and 88 million friends of friends of friends.
Thus, if everyone is sharing on social media about people they know who have been infected or killed by COVID-19, it can seem like the world is coming to an end. Yet, if people did the same for other deaths, each person would hear every year about an average of:
1,905 deaths among their friends of friends, and 761,844 deaths among their friends of friends of friends.
38 deaths from the flu and pneumonia among their friends of friends, and 15,075 such deaths among their friends of friends of friends.
Six deaths of people under the age of 65 from the flu and pneumonia among their friends of friends, and 2,385 such deaths among their friends of friends of friends.
In addition to social media, the press acts as another megaphone of COVID-19’s impacts. Because the US is the third-most populous nation in the world, it is easy for journalists to create misleading impressions by focusing on certain events and ignoring the broader context of facts that surround them. This kind of crucial context is missing from much of the media’s coverage of COVID-19 and practically every other public policy issue.
Transmissibility
Another important factor in weighing the risks posed by COVID-19 is its transmissibility, or how contagious it is. In this respect, COVID-19 is much more dangerous than the seasonal flu because it spreads very quickly and can overwhelm hospitals.
Scientists measure the contagiousness of diseases with a basic reproduction number, which is the average number of people who tend to catch a disease from each person who has it. This measure is an innate characteristic of the disease because it doesn’t account for actions that people take to prevent it. A February 2020 paper published in the Journal of Travel Medicine explains that any disease with a basic reproduction number above 1.0 is likely to multiply over time.
The same paper evaluates 12 studies of the basic reproduction number of COVID-19 in various nations and finds that they “ranged from 1.4 to 6.49,” with an average of 3.28 and a median of 2.79. Based on their analysis of these studies, the authors conclude that the basic reproduction number of COVID-19 will likely prove to be “around 2–3” after “more data are accumulated.”
In contrast, a 2014 paper in the journal BMC Infectious Diseases analyzes 24 studies of the seasonal flu and finds that the median result for the basic reproduction number is 1.28. The authors stress that the seemingly small difference between 1.28 and higher figures like 1.80
represent the difference between epidemics that are controllable and cause moderate illness and those causing a significant number of illnesses and requiring intensive mitigation strategies to control.
In other words, if the transmissibility of COVID-19 is as high as currently estimated, the aggressive measures that some governments, organizations, and individuals have taken to limit large gatherings and travel from areas with outbreaks will save many more lives than doing the same for common diseases like the flu. Because COVID-19 spreads so quickly, it can easily overwhelm hospitals and thereby prevent people from getting the care they would otherwise receive under normal circumstances.
Overreactions
There are, however, mortal dangers in overreacting because measures to limit the spread of COVID-19 often have economic impacts that can cost lives. As detailed in the textbook Macroeconomics for Today, countries with low economic growth “are less able to satisfy basic needs for food, shelter, clothing, education, and health.”
These hazards can manifest quickly and over extended periods of time.
If certain industries adopted the social distancing extremes that many people have embraced, this would shut down food production and distribution, health care, utilities, and other life-sustaining services. Even under far more moderate scenarios where people who are not in these industries shun work, all of those necessities and many more aspects of modern life depend on the general strength of the economy. Thus, overreacting can ultimately kill more people than are saved.
The same applies to people who are flooding supermarkets to stockpile food, toilet paper, and other supplies. In doing so, they have often stood in close proximity to each other and touched the same items, which opens avenues to spread the disease. Panic buying also creates shortages that deprive typical consumers of provisions.
Likewise, panic can fuel suicides, which snuff out about 47,000 lives per year in the US at an average age of 46 years old. Over a lifetime, that amounts to 132 million lost years of life—or 46 times the loss from COVID-19 if it ultimately kills 240,000 people.
The implications of overreacting to COVID-19 or any other potential hazard are aptly summarized in a teaching guide published by the American Society for Microbiology. This book explains why “the factors driving your concept of risk—emotion or fact—may or may not seem particularly important to you, yet they are” because “there are risks in misperceiving risks.”
The Path Forward
Aggressive social distancing can extend the timeframe over which COVID-19 patients are infected and hospitalized, but it cannot by itself reduce those outcomes in the long run. This is because COVID-19 is so contagious that another outbreak will begin and quickly proliferate as soon as the distancing measures cease.
Hence, the Imperial College’s March 16th report on COVID-19 states that in order to “avoid a rebound in transmission,” policies of “population-wide social distancing combined with home isolation of cases and school and university closure” must “be maintained until large stocks of vaccine are available to immunize the population—which could be 18 months or more.”
Moreover, the report notes that the “more successful a strategy is at temporary suppression, the larger the later epidemic is predicted to be in the absence of vaccination, due to lesser build-up of herd immunity.” A 2012 paper in the journal PLoS One about “Immunity in Society” underscores the importance of that point by noting that:
when a sufficiently high proportion of individuals within a population becomes immune (either through prior exposure or through mass vaccination), community or “herd” immunity emerges, whereby individuals that are poorly immunized are protected by the collective “immune firewall” provided by immunized neighbors. In humans and other vertebrate communities … responses to a previously encountered pathogen are faster and stronger than those to a novel pathogen, and thus individuals are better at blocking its spread. [Emphasis added.]
Equally, if very few people are immune to a disease, they can transmit it to others instead of blocking it. Without a vaccine, the only way people can become immune to COVID-19 is by catching it and recovering. This means that too much social distancing may cause more deaths because young, healthy people—who would otherwise catch the disease, recover quickly, and become firewalls—remain as potential carriers.
However, social distancing can keep hospitalizations at reasonable levels so that victims receive proper care, and it can also buy time to discover and mass-produce effective treatments. This is a distinct possibility in the short term, for as Michael Farzan, co‐chair of the Department of Immunology and Microbiology at Scripps Research, has stated, the same physical feature of the virus that makes it so contagious also makes it:
very vulnerable to antibody neutralization, and thus it is a relatively easy virus to protect against. I refer to it as “stupid” on a spectrum where HIV, which lives in the face of an active immune system for years, is a “genius.”
President Trump has touted a small French study showing that treatment with a combination of two drugs, hydroxychloroquine and azithromycin “is significantly associated with viral load reduction/disappearance in COVID-19 patients….”
The study was published in the International Journal of Antimicrobial Agents, and the 18 scholars who authored it wrote that the “results are promising” and “we recommend that COVID-19 patients be treated with” these drugs “to cure their infection and to limit the transmission of the virus to other people.” Nonetheless, media outlets have covered this matter by reporting that Trump “is not a doctor” and that he shouldn’t hype “unproven” and “untested” treatments or give people “false hope.”
Theatrics aside, the FDA has issued an Emergency Use Authorization that allows doctors to treat certain hospitalized COVID-19 patients with hydroxychloroquine and chloroquine “when a clinical trial is not available or feasible.” The authors of the French study make clear that their “study has some limitations including a small sample size, limited long-term outcome follow-up, and dropout of six patients from the study, however in the current context, we believe that our results should be shared with the scientific community.”
During a March 14 press conference, US Surgeon General Jerome Adams asserted that “this situation will last longer, and more people will be hurt” if “we are complacent, selfish, uninformed,” and if “we spread fear, distrust, and misinformation.” Conversely, he said that “we will overcome this situation” if we “pitch in” and “share the facts.”
The vital facts above confirm the wisdom of his words
– Notably, the first three known cases from early December had no contact with that market, and roughly one-third of the initial exposed cohort had no direct ties to Wusan’s wild meat market, the original presumptive source of the virus.
– Since its discovery, scientists have been unable to fully determine the zoological origins of 2019-nCoV, it was initially thought to have passed through snakes, but now all that’s agreed upon is that it’s mostly bat in origin. This inability to derive an exact zoological source is exactly what would be expected if the virus had been artificially engineered to target humans as UNC already has, this doesn’t prove an artificial nature – but it is consistent with one. Although there has been speculation that pangolins may have been the missing vector, the only data about the pangolin virome wasn’t entered into NCBI’s system until late January, and couldn’t possibly have been collected any earlier than late September 2019.
– A full-genome evolutionary analysis of 2019-nCoV published in The Lancet concluded, “recombination is probably not the reason for emergence of this virus” since it seems that the Wuhan Strain isn’t a mosaic of previously known coronaviruses, but instead draws from distant, discrete parts of the coronavirus family tree – not how these viruses naturally evolve. Because even mixing and matching coronavirus genomes from every known mammal, scientists couldn’t find any possible combination that would explain those regions of the Wuhan Strain’s genome. The Lancet muses that a mysterious animal host could still be out there, however since they’ve already searched through every known possibility and been unable to find a match, another obvious explanation is that bio-engineering accounts for the inexplicable regions of the Wuhan Strain’s genome
– Early research found that 2019-nCoV targets the ACE2 receptor, which is found in East Asians at roughly five-times the rate of other global populations, indicating that the Wuhan Strain 2019-nCoV was likely developed as part of a gain-of-function defensive project possibly linked to immunotherapy or vaccinations – never meant to leave the lab, but meant to serve as a Red Team to fight back against, not as an offensive weapon since the virus is likely wired to be more virulent among Asian populations. Further support for this is the fact that the Wuhan BSL-4 virology lab was already actively looking into the risks posed from bat coronaviruses, and actively researching coronavirus treatments – by definition both of these projects would require live virulent strains of coronavirus.
– The Wuhan Strain of coronavirus, 2019-nCoV, appears to be transmissible even before its host shows any symptoms at all, making temperature-scanning at airports ineffective since hosts appear to be contagious for about a week before any symptoms emerge. This is in stark contrast with SARS, whose hosts weren’t contagious until they were symptomatic, allowing for its relatively quick containment. This chart is not from a peer-reviewed source but was claims to capture the comparative rates of infections between recent outbreaks. A recent pre-print now gives 2019-nCoV a rating of R4, meaning each host passes the virus on to four new victims, a rate significantly higher than any past global viral outbreak.
– Following the aforementioned bat coronavirus bio-engineering research that was critiqued for being too risky in 2015, in the paper from UNC eventually published the next year that describing their successful bio-engineering of a highly-virulent coronavirus derived from bats, researcher #8 is listed as one “Zheng-li Shi” attached to the “Key Laboratory of Special Pathogens and Biosafety, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China.”
– Zhengli Shi seems to have returned to Wuhan at some point since 2016, specifically to the Wuhan Institute of Virology’s Disease Engineering Technical Research Center, since she then appears in this September 2019 paper on the human behaviors most likely to lead to bat-borne coronavirus exposure in southern China, which was very peculiarly published in coordination with the announcement of the outbreak, and in this pending preprint on the current outbreak of 2019-nCoV – just a sample of the dozens of coronavirus-related papers she’s published over a three decade career.
– Not only does Zhengli Shi provide a direct chain of expertise tying the already successful bio-engineering of a virulent bat-based coronavirus at UNC directly to the BSL-4 virology lab in Wuhan, but back in January 2014 she’d received a $665,000 grant from NIH for a study titled The Ecology of Bat Coronaviruses and the Risk of Future Coronavirus Emergence (NIAID R01 AI1 10964) as well as $559,500 more from USAID for a study titled Emerging Pandemic Threats PREDICT_2China (Project No. AID-OAA-A-14-00102). Beyond this American funding specifically into viral diseases zoonotically transferring from animals to humans which would slipped in just before the ban, over the years she’s also received around $3 million in grants to study these zoonotic viruses from China and other countries, and has served on the editorial board of several virological research magazines. More of her research into the intersection of coronaviruses like the Wuhan Strain and their epidemic potential was funded by the U.S. Department of Defense, the U.S. Threat Reduction Agency, and U.S. Biological Defense Research Directorate of the Naval Medical Research Center.
– And so a scientist who’s been prolifically involved with studying the molecular interaction of coronaviruses and humanity, spending decades and millions of dollars, and having even helped build a hyper-virulent coronavirus from scratch at UNC – just so happens to be working at the only BSL-4 virology lab in China that also just so happens to be at the epicenter of an outbreak involved a coronavirus that’s escaping zoological classification and whose novel spike-protein region shares more in common with a commercial genetic vector than any of its wild relatives, and has other unnatural characteristics that will be discussed below.
– Another Chinese virologist, Xing-Yi Ge, appears as an author on the 2016 UNC paper and is also attached to the lab in Wuhan. Previously in 2013, he’d successfully isolated a SARS-like coronavirus from bats which targets the ACE2 receptor, just like our present virus, the Wuhan Coronavirus 2019-nCoV uses. And it turns out that the Wuhan Strain’s ACE2 receptor’s genes are quite unique: they’re almost identical to SARS’s spike-protein genes – despite the fact that almost none of the two coronavirus’s genomes are similar anywhere else at all. Beyond that, although the Wuhan Strain’s spike-protein genome differs from SARS in four out of the five most important genomic spots that determine binding to the ACE2 receptor, they surprisingly don’t effect the protein-spike’s shape. And in an even bigger coincidence, these four spots also code for the outside region of the spike that allows entry into cells, and do not effect it either – allowing the Wuhan Strain to still use the ACE2 receptor to unlock cells while possibly gaining additional capabilities. The odds that this concordance was bio-engineered into the virus are several orders of magnitude more likely than for this to randomly have evolved in nature.
– Numerous videos purportedly from inside hospitals in Wuhan depict a crisis that is far greater than the numbers released by China to date. There is widespread but unverified online reporting that Wuhan crematoriums have been running 24/7, which is consistent with a recent peer-reviewed study that claims that as of January 25, Wuhan had over 75,000 infections – when the official number was just 761. Chinese language social media also reflects a sense of panic and desperation that is highly discordant with the numbers being released by the Chinese government. Who, notably, are refusing any direct assistance from the American CDC. (Evidence that China is vastly downplaying this pandemic’s severity: Example 1. Example 2. Example 3. Example 4. Example 5. Example 6.)
– Additionally, although another since-retracted pre-print noted several very short genomic sequences in 2019-nCoV’s spike-protein gene that look far more similar to sequences found in HIV than to other coronaviruses – critics quickly pointed out that the shared homology didn’t reach statistical significance. However a closer look at the data reveals that there were a few small shared genomic segments that, despite being physically separated from each other along each strand of DNA, all worked together to code for the Wuhan Strain’s protein-spike’s crucial receptor binding site. Something that is highly unlikely to have happened by chance. And despite most of its protein-spike being shared with SARS, these substituted segments weren’t shared at all – nor were they found in any other coronavirus. It is mathematically possible for this to happen in nature – but only in a ten-thousand bats chained to ten-thousand Petri dishes and given until infinity sense.
– Critics have brushed off the Wuhan Strain’s shared homology with HIV as statistically insignificant, however clinical reporting indicates that the Wuhan Strain may be using this shared HIV homology to attack CD4 immune cells just like HIV does, as an unusually high percentage of patients are showing low white blood cell counts, especially the sickest ones. This pathogenicity may well be due to the unique HIV-live genomics of the Wuhan Strain, as one white-paper by LSU’s professor emeritus of Microbiology, Immunology, and Parasitology who’s also a Harvard-educated virologist with a PhD in Microbiology and Molecular Genetics notes: “This is the first description of a possible immunosuppressive domain in coronaviruses or nCoV2019. The three key [mutations] common to the known immunosuppressive domains are also in common with the sequence from [the spike-protein]. While coronaviruses are not known for general immunosuppression of the style shown by HIV-1, this does not rule out immunosuppression at the site of active infection in the lung, which would prolong and potentially worsen infection at that site.”
– And it should be noted that SARS – much ballyhooed as a close relative to the Wuhan Strain – didn’t notable effect white blood cell counts. Additionally, clinical treatment guides published online in late January by established Chinese medical sources note the progressive reduction of white blood cells, as well as the importance of monitoring this decline. And reporting from Thailand indicates that adding a cocktail of two different anti-HIV drugs to the typical flu treatment regime seemed to effectively knock back the Wuhan Strain.
– In a highly concerning turn, scientists have noted that the Wuhan Strain can have a “striking” short term rate of mutation which doesn’t indicate an artificial origin but captures the unique threat posed by this coronavirus regardless of its providence, since a faster mutation rates makes it more likely this virus can dodge testing and neutralize vaccines. Something there is already early evidence for.
– Giving further credence to the idea that the Wuhan Strain was bio-engineered is the existence of a patent application that looks to modulate a coronavirus’ spike-protein genes – the precise region altered by Zhengli Shi at UNC to make a hyper-virulent strain of coronavirus, and whose alteration and adaptation would explain the Wuhan Strain’s unusual behavior as discussed above.
– And curiously, the head of Harvard’s Chemistry Department, Dr. Charles Lieber, was arrested in the midst of this outbreak on charges that he’d been accepting millions of dollars in bribes from the Chinese government. According to his charging documents, Dr. Lieber first went to the Wuhan University of Technology (WUT), in November 2011 to participate in a nanotechnology forum, which was when he was recruited into a bribery scheme that would net him several million dollars to “establish a research lab and conduct research at WUT,” which became known as ” Joint Nano Key Laboratory,” as well as mentor and advocate for graduate students. By 2015, Dr. Lieber appeared to be fairly intimately involved with what seemed to begin as simply a nanotechnology lab, but now had shifted to involve biology as well, since he described visiting the lab multiple times per year “as we try to build up the nano-bio part of the lab.” Whether or not this nano-bio part of the Nano Key Laboratory is related to Wuhan’s BSL-4 virology lab isn’t clear, however if the Wuhan Strain was bio-engineered, technology classified as “nano-bio” would’ve almost certainly played a role.
Given the above facts, either:
– A coronavirus spontaneously mutated and jumped to humans at a wet market or deep in some random bat cave which just so happened to be 20 miles from China’s only BSL-4 virology lab, a virus with an unusually slippery never-before-seen genome that’s evading zoological classification, and whose spike-protein region which allows it to enter host cells appears most like a bio-engineered commercial product, that somehow managed to infect its first three and roughly one-third of its initial victims despite them not being connected to this market, and then be so fined-tuned to humans that it’s gone on to create the single greatest public health crisis in Chinese history with approaching 100 million citizens locked-down or quarantined – also causing Mongolia to close its border with its largest trading partner for the first time in modern history.
– Or, Chinese scientists failed to follow correct sanitation protocols possibly while in a rush during their boisterous holiday season, something that had been anticipated since the opening of the BSL-4 lab and has happened at least four times previously, and accidentally released this bio-engineered Wuhan Strain – likely created by scientists researching immunotherapy regimes against bat coronaviruses, who’ve already demonstrated the ability to perform every step necessary to bio-engineer the Wuhan Strain 2019-nCov – into their population, and now the world. As would be expected, this virus appears to have been bio-engineered at the spike-protein genes which was already done at UNC to make an extraordinarily virulent coronavirus. Chinese efforts to stop the full story about what’s going on are because they want the scales to be even since they’re now facing a severe pandemic and depopulation event. No facts point against this conclusion.
xxxxxxxxxxxx
Israeli scientists: 'In a few weeks, we will have coronavirus vaccine'
Once the vaccine is developed, it will take at least 90 days to complete the regulatory process and potentially more to enter the marketplace.
By MAAYAN JAFFE-HOFFMAN APRIL 7, 2020 15:03Email Twitter Facebook fb-messenger
Israeli scientists are on the cusp of developing the first vaccine against the novel coronavirus, according to Science and Technology Minister Ofir Akunis. If all goes as planned, the vaccine could be ready within a few weeks and available in 90 days, according to a release.
“Congratulations to MIGAL [The Galilee Research Institute] on this exciting breakthrough,” Akunis said. “I am confident there will be further rapid progress, enabling us to provide a needed response to the grave global COVID-19 threat,” Akunis said, referring to the disease caused by the novel coronavirus.
For the past four years, a team of MIGAL scientists has been developing a vaccine against infectious bronchitis virus (IBV), which causes a bronchial disease affecting poultry. The effectiveness of the vaccine has been proven in preclinical trials carried out at the Veterinary Institute.
MIGAL is located in the Galilee.
“Our basic concept was to develop the technology and not specifically a vaccine for this kind or that kind of virus,” said Dr. Chen Katz, MIGAL’s biotechnology group leader. “The scientific framework for the vaccine is based on a new protein expression vector, which forms and secretes a chimeric soluble protein that delivers the viral antigen into mucosal tissues by self-activated endocytosis, causing the body to form antibodies against the virus.”
MIGAL laboratory (Photo Credit: Lior Journo)MIGAL laboratory (Photo Credit: Lior Journo)
Endocytosis is a cellular process in which substances are brought into a cell by surrounding the material with cell membrane, forming a vesicle containing the ingested material.
In preclinical trials, the team demonstrated that the oral vaccination induces high levels of specific anti-IBV antibodies, Katz said.
“Let’s call it pure luck,” he said. “We decided to choose coronavirus as a model for our system just as a proof of concept for our technology.”
But after scientists sequenced the DNA of the novel coronavirus causing the current worldwide outbreak, the MIGAL researchers examined it and found that the poultry coronavirus has high genetic similarity to the human one, and that it uses the same infection mechanism, which increases the likelihood of achieving an effective human vaccine in a very short period of time, Katz said.
“All we need to do is adjust the system to the new sequence,” he said. “We are in the middle of this process, and hopefully in a few weeks we will have the vaccine in our hands. Yes, in a few weeks, if it all works, we would have a vaccine to prevent coronavirus.”
MIGAL would be responsible for developing the new vaccine, but it would then have to go through a regulatory process, including clinical trials and large-scale production, Katz said.
Akunis said he has instructed his ministry’s director-general to fast-track all approval processes with the goal of bringing the human vaccine to market as quickly as possible.
“Given the urgent global need for a human coronavirus vaccine, we are doing everything we can to accelerate development,” MIGAL CEO David Zigdon said. The vaccine could “achieve safety approval in 90 days,” he said.
It will be an oral vaccine, making it particularly accessible to the general public, Zigdon said.
“We are currently in intensive discussions with potential partners that can help accelerate the in-human trials phase and expedite completion of final-product development and regulatory activities,” he said
xxxxxxxxxxxxxxxx
The Hunt for Patient Zero
Unz
Another American Index Case?
GODFREE ROBERTS • APRIL 10, 2020 • 2,800 WORDS • 9 COMMENTS • REPLY
In our last episode, Last Man Standing, we wondered if the Covid-19 outbreak might prove advantageous to China. Here we speculate about how–thanks to a bureaucratic decision about a common illness–it may cause America to lose world hegemony.
***
Finding the Index Case, Patient Zero, of an epidemic is critical to understanding and curbing further transmission. Dating its first appearance, sequencing its genomes, following the changes in its genetic structure, and finding the root of its genetic family tree help estimate the epidemic’s scale and scope of transmission, find intermediate hosts, understand how spreading took place and curb future transmission by focusing resources to contain it. Since genetic sequencing data can only come from those who are diagnosed, health workers still rely on contact tracing to find people whose infections have gone undetected. Once a patient is diagnosed, their primary contacts must be located and questioned about relevant symptoms and, if any of those contacts themselves fall ill, they trigger a second layer of contact tracing and the workload grows exponentially. Covid-19’s long incubation and asymptomatic transmission can make the search herculean: Indian health officials contacted 2,666 people after the first case was confirmed in Karnataka.
Every public health official on earth knows this yet, despite its WHO obligations, the CDC refuses to identify America’s Patient Zero and attacks those–including the WHO itself–who requests the information. The thesis of this article is that the CDC’s coverup will fail and the consequent revelations will hasten the fall of our First Republic[1].
***
In 2012, the Rand Corporation concluded, ‘the only threats capable of destroying America’s way of life are pandemics.’ In 2015, after Ezra Klein spoke with Bill Gates about his algorithmic model showing how a new strain of flu could spread rapidly he wrote, “A pandemic disease is the most predictable catastrophe in the history of the human race, if only because it has happened to the human race so many, many times before.” In 2017, Dr. Anthony Fauci expressed ‘no doubt’ that President Trump would face a viral pandemic during his tenure. In 2019, HHS’ Crimson Contagion pandemic report, marked ‘not to be disclosed,’ found Federal agencies jockeying over who was in charge, states and hospitals struggling to figure out what equipment was stockpiled or available, and cities and states going their own ways on group and school closings. This is truly astonishing, since
Patient Zero for both the Spanish Flu and Swine Flu (the deadliest[2] pandemics of their centuries), were Americans.
Our public health system is so ineffectual that we now host endemic diseases like typhus, usually seen only in wartime.
Our public health system is so ineffectual that our healthy life expectancy at birth is lower than China’s.
The CDC is remarkably corrupt.
The CDC has often been slow to detect pandemic outbreaks and incurious about tracing them.
The CDC classifies discussions of Covid-19 Top Secret.
The CDC is led by a non-scientist military officer.
The CDC did nothing when the WHO issued its warning January 3.
The CDC blocked Covid-19 testing for months after thousands started dying.
The CDC has been dismantling our public health system. In 2018 the White House pushed Congress to eliminate $252 million for disease security programs and reduce health spending by $15 billion by cutting the global disease-fighting operational budgets of the CDC, NSC, DHS, and HHS and eliminating the $30 million Complex Crises Fund. The President ordered the National Security Council’s Global Health Security unit shut down and reassigned Adm. Timothy Ziemer and his team. Then-National Security Advisor John Bolton pressured Adm. Ziemer’s DHS counterpart, Tom Bossert to resign, too, and neither team was replaced. Much of the staff of the CDC’s Global Health section was laid off and cooperating countries were cut from forty-nine to ten, and CDC Director Robert Redfield sought a further $7 billion cut for FY 2021. Last November a bipartisan panel convened by the CSIS concluded, “The United States must either pay now to gain protection and security or wait for the next epidemic and pay a much greater price in human and economic costs.”
A Series of Unfortunate Events.
On June 30, 2019, a pneumonia of unknown cause at Greenspring, a nursing home fifteen minutes from Fort Belvoir[3], VA, killed three and sickened 54.
On July 9th, another pneumonia of unknown cause was reported in Alexandria, VA and all lung images showed the ‘ground glass’ shadow typical of Covid-19. Coincidentally, the CDC chose that date to withdraw the only American epidemiologist embedded with Beijing’s CCDC. The following week a pneumonia epidemic was reported at a nursing home in Burke, VA and the Virginia State Health Bureau banned collective activities and began screening residents in assisted care facilities and requiring enhanced hygiene. In early August the CDC expanded its pneumonia patient detection system and, in an unprecedented civilian intervention in military affairs, shut down the Army’s main military biowarfare lab (and Superfund site), Fort Detrick, MD where, a senior scientist said, the atmosphere was one of “fear and mistrust.”
In late August, the Virginia Department of Health confirmed three more cases of severe lung illness of unknown origin. Between August-October, 2,500 patients reported gastrointestinal symptoms beginning before respiratory symptoms, with fever, elevated heart rate, and elevated white blood cell count–all symptoms typical of Covid-19. Many sought ambulatory care several times before hospitalization and their lung images showed a ‘ground glass’ shadow. Fifty percent needed intubation, many required supplemental oxygen, and some required assisted ventilation. Fifty-three died and the cause of the outbreak remains unexplained[4]. A similar outbreak[5] was occurring simultaneously in Lombardy, Italy.
The following month the Deputy Director of the CIA participated in a pandemic tabletop exercise, Event 201, that modeled a fictional coronavirus pandemic and, after years of reducing headcount, the CDC began hiring quarantine managers:
In January, after private briefings on the COVID-19 pandemic, five senators avoided significant losses by selling major stock holdings and 219 CEOs, the largest cohort ever, retired at the top of the stock market.
On January 3 ILINet[6] was functioning normally when the WHO alerted the CDC to Covid-19. When Beijing uploaded its genetic sequence a week later the CDC forbade its sentinels, including UW’s Dr. Helen Chu[7], to test for it. A New York Times reader commented[8] that such information suppression is common with the CDC, “I presume her lab continues to conduct the tests for research but is barred from sharing the results with public health authorities. I used to be the principal investigator on an IRB-approved, non-clinical brain imaging study for research many years ago. We decided that in the rare case we detected an abnormality in a participant’s brain, we would strongly suggest that they consult a clinician. Similarly, perhaps your lab could inform a participant testing positive for the virus in your study to seek medical attention immediately.” Two months later Dr. Chu ignored the CDC’s injunction and immediately discovered Covid-19 fatalities in Seattle. The CDC still obstructs and discourages testing.
DETROIT – A NURSE was found dead from coronavirus after her employer reportedly refused to test her because she wasn’t showing symptoms. Lisa Ewald, 53, worked as a nurse at Henry Ford Hospital in Detroit for more than 20 years but died last week after being exposed to the deadly virus. Ewald said she believed she was exposed to the coronavirus by a patient around March 24 while working in the emergency room. Neighbor Alexis Fernandez said Ewald immediately tried to get herself tested, but was told by her employer she couldn’t until she showed symptoms. According to her family, the nurse was refused a test twice.
WASHINGTON — A coroner in Indiana wanted to know if the coronavirus had killed a man in early March, but said that her health department denied a test. Paramedics in New York City say that many patients who died at home were never tested for the coronavirus, even if they showed telltale signs of infection. In Virginia, a funeral director prepared the remains of three people after health workers cautioned her that they each had tested positive for the coronavirus. But only one of the three had the virus noted on the death certificate. Across the United States, even as coronavirus deaths are being recorded in terrifying numbers—many hundreds each day—the true death toll is likely much higher. New York Times, April 7, 2020.
Hunting for Patient Zero
Chinese research shows that the virus was introduced into their country from elsewhere, Japanese and Taiwanese studies point to the US as its likely source, and Russian and Czech authorities share their suspicions.[9] Kristian Andersen, a Scripps Institute evolutionary biologist, said it is ‘entirely plausible’ that infected persons brought the virus into the seafood market from somewhere outside and dated their ‘most recent common ancestor’ as early as 1 October 2019, when US athletes participated in the 2019 Military World games in Wuhan. Daniel Lucey, an infectious disease expert at Georgetown University, said the first infection has been confirmed as occurring in November 2019, (not in Wuhan), suggesting the virus originated elsewhere. “One group put the origin of the outbreak as early as 18 September 2019. China must have realized the epidemic did not originate in that Wuhan Huanan seafood market.” Lucey also noted that MERS was originally believed to have come from a patient in Saudi Arabia in June of 2012 but later, more thorough studies traced it to an earlier hospital outbreak of unexplained pneumonia in Jordan in April of that year and Western media’s origin stories about SARS, MERS, and ZIKA have all later proven wrong.
Circumstantial Evidence
The Director of the CDC is a career military officer and a non-scientist.
The CDC blocked Covid-19 testing for months and still obstructs it.
The CDC discusses Covid-19 in a top secret, secure facility because, staffers said, “It has something to do with China.”
Only under persistent Congressional questioning did the CDC Director reluctantly reveal the existence of earlier cases that had been diagnosed as influenza.
The CDC Director flatly refuses to discuss Patient Zero.
Western media show no interest in investigating Patient Zero.
Western media dismiss questions about Patient Zero as ‘political’ despite the fact that they are scientific.
Powerful US Government officials acted on foreknowledge of the epidemic
The media have been attacking the World Health Organization for months.
President Trump has threatened to de-fund the WHO.
***
Death of a Thousand Cuts
It appears that China has chosen to play offense this time and its weapons may prove decisive. Most American medical laboratories employ Chinese researchers, some of whom smuggled hospital tissue samples to China during the period under discussion. This explains the FBI’s medical panic[10] last Fall, the CDC’s secrecy, and the Chinese Government’s brazen demand that the US reveal Patient Zero. If China has biological samples of American Covid-19 from 2019, then its demand is just the opening shot in a war of perceptions. Uncharacteristically, Chinese diplomats have ensured that a global audience is paying attention by repeating its challenge in major languages:
Next, to garner publicity for an analysis that could have been performed on a desktop, China chose Tianhe, the world’s first petaflop computer, to compare lung images attributed to vaping and to Covid-19. Using AI-assisted analysis whose algorithm’s accuracy is over 99 percent, Tianhe-1 found a high probability of Covid-19 in the CAT image of a patient who became severely ill between July and August in North Carolina. The features included white patches encroaching on the lower parts of both lungs, a phenomenon raising the eyebrows of some radiologists at the early stage of the outbreak because it was rarely seen in other types of pneumonia. Said the AI-generated report, “The image shows features of Covid-19, and a comprehensive diagnosis is recommended in combination with epidemiological information and other clinical characteristics.” The patient was one of five who presented at the WakeMed Hospital in Raleigh, North Carolina at about the same time, with acute lung injuries, according to information on the CDC website. Dr Kevin Davidson, who led a medical team that examined the patients at WakeMed, defended the original diagnosis but, said a Wuhan doctor, “The disagreement between Tianhe and WakeMed could be resolved by a laboratory test for the new coronavirus in the patient’s samples. If the samples are no longer available, an antibody test can be performed instead.” Pigs will fly…
Truth and Consequences
There are more rounds to be fought but, if China wins, will be sweet revenge for America’s many biological attacks since 1951[11], including Harvard’s theft of thousands of biological samples in the 1990s, and recent epidemics of mysterious origins. With ninety percent of its workforce already back in operation, if China does wins, where will the world be in twelve months if
Covid-19, like Swine Flu and Spanish Flu, began in the United States?
Covid-19 began at a notoriously unsafe military biowarfare facility?
The US Government and media covered it up?
The US blamed an innocent nation?
The US scapegoated the WHO?
The US mishandled its own outbreak disastrously?
The US coverup precipitated another financial crisis?
China again rescued the world from the American recession?
For politicians seeking to deflect attention from their own shortcomings and curry favor with the new superpower, blaming America may prove irresistible.
Postscript: That HHS and the CDC might be involved in villainy is not news. In the 1980s Linus Pauling described the criminal lengths to which HHS went to discredit years of promising research on Vitamin C’s effects on the longevity of thousands of cancer patients.
Notes
[1] To understand how and why republics fall, read The Collapse of the Third Republic: An Inquiry into the Fall of France in 1940, by William L. Shirer.
[2] Patient Zero for the 1918 ‘Spanish Flu’ was traced to Kansas City. Patient Zero for H1N1 officially occurred in San Diego in April, 2009, but three unrelated clusters during March suggest that transmission began earlier.
[3] The US Military Games team trained at Fort Belvoir before competing in Wuhan.
[4] The CDC does not actually count and then report the number of people who contract influenza or pneumonia during the flu season, “Because influenza surveillance does not capture all cases of flu that occur in the U.S., CDC provides these estimated ranges to better reflect the larger burden of influenza. These estimates are calculated based on CDC’s weekly influenza surveillance data and are preliminary.” The numbers are statistical estimates only.
[5] Doctor Giuseppe Remuzzi, director of the Mario Negri Pharmacology Institute in Milan, became a superstar in China. In an interview that went viral, Remuzzi talks about his explosive findings in conversations with general practitioners in Lombardy. “Do you know what happened? Certain family doctors, who have the best antennas in the territory, at least the most able and attentive ones, have told me recently that they were seeing grave cases of pneumonia, which we had never seen in other years. These pneumonia cases had nothing to do with typical flu pneumonia, they were interstitial pneumonias, they had to do CT, radiography [to diagnose it], and this was seen in October, November, December. So this virus has been circulating a long time.” That was indeed in parallel with or even before the first coronavirus cases in Wuhan in mid-November. It’s been already scientifically established that the virus strains in Wuhan and in Lombardy are different. Which came first, and where from, remains a matter of incendiary debate.
[6] The US Outpatient Influenza-Like-Illness Surveillance Network of three-thousand sentinel health care providers who report the weekly percentage of outpatient ILI visits to the CDC. China’s network, modeled on the CDC’s, has 70,000 sentinels.
[7] Washington state epidemiologist Scott Lindquist recalled, “What they said on that phone call very clearly was cease and desist to Helen Chu. Stop testing.” Reason
[8] Comment from Why The US Wasn’t Ready for the Coronavirus. NYT 03/11/2020.
[9] March 29. Tass, “In order to unambiguously answer the question about the origin, where the first case emerged, major research needs to be carried out. So, Washington’s accusing tone in comments against China occasions utter bewilderment. As for ‘US trace’ in the COVID-19 outbreak, we don’t have this data yet. However, for a long time we have been watching with concern the US military and biological activity carried out in direct proximity with our borders. In other words, there are indeed questions for the US.”
[10] Including the arrest of Charles M. Lieber, Chair of Harvard’s Department of Chemistry and Chemical Biology and leader of a Chinese research group using nanotechnology to identify viruses.
[11] See The Report of the International Scientific Commission for the Investigation of the Facts Concerning Bacterial Warfare in Korea and China. Sir Joseph Needham, Lead Autho
xxxxxxxxxxxxxxxx
HCQ
Paul Craig Roberts
Dear Mr. President:
I humbly suggest the following:
It is essential to start treatment against Covid-19 immediately upon clinical suspicion of infection and not to wait for confirmatory testing. There is a very narrow window of opportunity to eliminate the virus before pulmonary complications begin. The waiting to treat is the essence of the problem.
Emphasis must be to prevent complications in the outpatient setting and not to wait until the patient needs to be admitted in the hospital and put on a respirator. This will eliminate the respirator shortness and lower mortality significantly.
The risk of side effects is exaggerated and is fear mongering. The theoretical risk of QT prolongation is 1 in 1000. The actual risk of death in the high risk population is between 5 to 10%. The risk vs benefit analysis overwhelmingly favors treatment.
This is World War lll (virus vs humanity). We don’t have time to wait for the results of a long study. Millions will die while we wait. We need to initiate immediate treatment of high risk patients in the outpatient setting.
Any obstruction to life saving medication (HCQ) should be viewed has crimes against humanity.
Prophylaxis should be considered in the very high risk patients (i.e. nursing homes).
We need an immediate supply of 1.5 billion pills of HCQ 200mg, 500 million pills of Azithromycin 500mg, 500 million pills of zinc sulfate 220mg (or its equivalent – we need 50mg elemental zinc).
I suggest the following immediate treatment regimen of high risk patients with symptoms:
Hydroxychloroquine 200mg twice a day for 5 days
Azithromycin 500mg once a day for 5 days
Zinc sulfate 220mg once a day for 5 days
I suggest the following prophylactic regimen for very high risk patients:
Hydroxychloroquine 200mg once a day for 5 days, and then 1 pill a week until immunity can be shown or a vaccine becomes available.
Zinc Sulfate 220mg once a day for 5 days, and then 1 pill a week until immunity can be shown or a vaccine becomes available.
We need an executive order to override any state obstacles and allow all physicians to prescribe the medication without the fear of liability or retribution. Pharmacies must be permitted to dispense this medication without the fear of liability or retribution.
The Task force must announce that physicians must treat patents early and aggressively, even without confirmatory testing. If test comeback negative, the patient could be advised to stop the medication.
With much respect,
Dr. Vladimir (Zev) Zelenko
xxxxxxxxxxxxxxxxxxx
US diplomats involved in trafficking of human blood and pathogens for secret military program
By Dilyana Gaytandzhieva -September 12, 201874138078
Dilyana
Pentagon scientists have been deployed in 25 countries and given diplomatic immunity to research deadly viruses, bacteria and toxins at US military offshore biolaboratories under a $2.1 billion DoD program. (Source: DTRA)
The US Embassy to Tbilisi transports frozen human blood and pathogens as diplomatic cargo for a secret US military program. Internal documents, implicating US diplomats in the transportation of and experimenting on pathogens under diplomatic cover were leaked to me by Georgian insiders. According to these documents, Pentagon scientists have been deployed to the Republic of Georgia and have been given diplomatic immunity to research deadly diseases and biting insects at the Lugar Center – the Pentagon biolaboratory in Georgia’s capital Tbilisi.
This military facility is just one of the many Pentagon biolaboratories in 25 countries across the world. They are funded by the Defense Threat Reduction Agency (DTRA) under a $ 2.1 billion military program – Cooperative Biological Engagement Program (CBEP), and are located in former Soviet Union countries such as Georgia and Ukraine, the Middle East, South East Asia and Africa.
Instead of investing in the health of its own citizens the US government has spent $161 million of US taxpayer money on the Lugar Center in Tbilisi for research on deadly diseases and biting insects abroad. (©Al Mayadeen TV)
The secret facility is located just 17 km from the US Vaziani military airbase in Georgia’s capital Tbilisi.
The Pentagon biolaboratory is heavily guarded. All passers-by within a radius of 100 m are filmed although the military biolaboratory is located within a residential area.
I am being filmed while talking to local residents on the street near the Pentagon biolaboratory and I want to know why the security guards are filming me. (©Al Mayadeen TV)
The security guards warn me that if I do not comply, show my passport and leave this place, I will be arrested. My official request to the Lugar Center for access to the facility and for interviews has also been rejected.
Secret experiments at night
However, I go back at night when the laboratory is seemingly still working. No matter how far the distance the air is laden with the smell of chemicals. This smell coming from the Lugar Center at night is blown by the wind to the residential area. Local residents from the Alexeevka neighbourhood, where the laboratory is located, complain that dangerous chemicals are being secretly burnt at night and that hazardous waste is being emptied into the nearby river through the laboratory’s pipes.
A diplomatic car with US Embassy registration plates can be seen in the car park of the Lugar Center at night when the laboratory is seemingly still working. (©Al Mayadeen TV)
A few hours later, the diplomatic vehicle is still in the car park of the Lugar Center. There is a strong smell of chemicals in the area. (©Al Mayadeen TV)
Locals complain of constant headaches, nausea, high blood pressure and dizziness when chemicals are being burnt at night in the laboratory which is just a couple of hundred meters from their homes.
“There is a smoke – black, red, green at night or especially early in the morning at around 3, 4 a.m. Even the hens have died. They put a big pipe underground and connected it to the drains. This smell comes from there. It smells like rotten eggs and decaying hay. The smell is so bad and is spread in different directions by the wind”, says Eteri Gogitidze who lives in a block of flats next to the laboratory.
“I have a thyroid disease. There are families of three people in the neighborhood and all three of them have a thyroid disease. They say it is because of the laboratory”, explains Eteri Gogitidze from the Alexeevka Neighbouthood where the laboratory is located. (©Al Mayadeen TV)
Albert Nurbekyan who lives about 300 m from the laboratory shows the four chimneys from the Lugar Center which release smoke at night. (©Al Mayadeen TV)
“Sometimes the wind spreads a smell of rotten eggs. Once I woke up early in the morning and noticed violet smoke coming from the laboratory. At night time they let the smoke out so that people don’t see. Why at night, what are they hiding from us?, he asks and then provides another worrying fact: “There are big blue plastic pipes along this street (from the laboratory) and from where everything goes to the river which is 3-4 km away. Not only do they pollute our air, but they also poison our water.”
Locals: Poisonous gas killed two Filipinos
Neighbours recall a tragic incident involving four Filipinos who worked at the Lugar Center. Two of the foreigners died of an alleged gas poisoning in their rented flat in block 44 of the Alexeevka Settlement.
“The first time when they called the Emergency service we were told that they had food poisoning from fish. But the second time when the ambulance came there was foam coming out of their mouths. They were shouting: “Help, Help!” When they passed away, they took them away and covered it all up. It all happened here”, Albert Nurbekyan shows the sealed off flat where the foreign scientists died.
Another witness, Elvira Ratiani who lived next door witnessed the foreigners die before her eyes. “They were my neighbors, we lived on the same floor, and once they were poisoned, and asked us to call the Emergency service. We phoned and the Emergency service saved them. They said it was probably fish poisoning. The second time, they knocked on the door and again asked for help. There were four Filipinos, two of them were saved, but the other two died”, recalls Elvira Ratiani who lives in the fatal block 44 of the Alexeevka Settlement right next to the laboratory.
Human blood and pathogens as diplomatic cargo to the US Embassy – leaked documents
Internal documents and correspondence between the Ministry of Health of Georgia and the US Embassy to Tbilisi show what experiments have been conducted at the Lugar Center. Leaked documents reveal that the US Embassy to Tbilisi transports pathogens, as well as frozen human blood, as diplomatic cargo.
The US Embassy to Tbilisi is the address to which pathogens and blood samples are being shipped as diplomatic cargo. The Embassy’s press office declined to comment. (©Al Mayadeen TV)
This letter from the Ministry of Health of Georgia to the US Embassy in Tbilisi exempts the importation from registration as the American diplomats claim the frozen human blood is needed for research purposes in connection with an American program on Hepatitis C in Georgia.
Diplomatic cargo shipments are exempt from inspection and taxes. According to instructions from The Pentagon’s Defense Threat Reduction Agency (DTRA), which oversees and funds the laboratories, biological material for the needs of the program must be shipped as hand-carrying items to the US embassies.
In cases of importing to Russia, this biological material must be carried by diplomats in a diplomatic pouch and sealed as diplomatic cargo.
The Pentagon: Prostitutes strictly prohibited, no sex abroad
Other instructions to US personnel working under the military program prohibit the use of prostitutes, and any interaction with individuals who may reasonably be assumed to be working as prostitutes.
Romantic, intimate or sexual relations with local citizens or among team members are strongly discouraged as “foreign security services are known to use the enticement of such relations to exploit foreign officials”. As such, a relationship with foreign nationals must be reported to DTRA as soon as possible, the document reads.
US scientists test viruses under diplomatic immunity
Tasked with the program at the Lugar Center are biologists from the US Army Medical Research Unit-Georgia (USAMRU-G) along with private American contractors and the US Center for Disease Control (CDC). Certain zones of the laboratory are classified zones and are accessible only to American citizens with security clearance. They are accorded diplomatic immunity under the 2002 US-Georgia Agreement on defense cooperation.
The USA-Georgia agreement accords diplomatic status to the US military and civilian personnel (including diplomatic vehicles), working on the Pentagon program in Georgia.
Joshua Bast is the deputy director of the US Army Medical Research Unit-Georgia (USAMRU-G). The American military scientist drives a diplomatic car and enjoys diplomatic immunity, without being a diplomat.
Joshua Bast leaves the Lugar Center in a diplomatic car of the US Embassy to Tbilisi. (©Al Mayadeen TV)
He has been deployed to Georgia since 2015 by the Pentagon Walter Reeds Army Institute of Research. His military unit also operates a separate laboratory inside the Lugar Center – the Walter Reeds Army Institute of research laboratory. However, when I confront him at the entrance of the laboratory, he flatly denies that he works at the Lugar Center.
However, leaked e-mails between the Pentagon and the Georgian Ministry of Health (below) proves him wrong. Joshua Bast does work at the Lugar Center.
Joshua Bast is the deputy director of USAMRU-Georgia, according to leaked correspondence between the Pentagon medical research unit in Georgia and the Georgian Health Ministry. The address of USAMRU-Georgia indicated in this official e-mail (above) is the address of the Lugar Center (16 Kakheti Highway, Tbilisi).
Why does a Pentagon employee lie about his workplace? I have not received any answer. Joshua Bast drives off immediately after being challenged. He is not the only US non-diplomat working on the Pentagon program, who has been accorded diplomatic immunity. There are six diplomatic cars in the car park of the laboratory, all of them with registration plates of the US Embassy.
Six diplomatic vehicles of the US Embassy are parked in the car park of the Lugar Center. (©Al Mayadeen TV)
The Lugar Center security guard warns me to stay where I am and not to move. However, I run away. (©Asya Ivanova)
After I refuse to comply the security guards jump into an unmarked car. But I manage to escape.
Security guards are patrolling the area around the laboratory while I am hiding on the nearby bridge. (©Asya Ivanova)
These security guards patrolling the area around the laboratory in an unmarked car are paid for by the Pentagon and not by the government of Georgia, according to information obtained from the US Federal Contract registry. Hence, Georgia has no control over the activities of its foreign sponsor. Furthermore, the Pentagon scientists can work in direct violation of international law.
International law is not applicable
Under a 3 year-long agreement between the Walter Reeds Army Institute and the Georgian National Center for Disease Control (NCDC), the Pentagon has been given full access to the local collection of deadly bio agents in order to study them. These are agents which can cause Anthrax, Tularemia, Brucella and plague.
According to the agreement’s provisions, “international law is not applicable to this Agreement, the parties agree that no court, tribunal or international entity has jurisdiction or authority to consider or provide judgement in case of disputes arising between the parties of this agreement”.
Drone for releasing of toxic mosquitoes
The work that US diplomats perform at the Lugar Center has nothing to do with diplomacy and does not fall under the Vienna Convention on Diplomatic Relations. Joshua Bast, for instance, is an entomologist and researches insects, according to a video released by the US Embassy to promote the peaceful purposes of the otherwise military program of the US in Georgia.
A screen grab from a video promoting the peaceful intentions of the Pentagon program. Joshua Bast is presented as entomologist.
Why does an entomologist work for the US Army and why is he accorded diplomatic immunity? Entomological warfare is a type of biological warfare that uses insects to transmit diseases. Georgia borders on the US main rival – Russia. Moscow has repeatedly voiced its concerns about the potential development of biological weapons near the Russian borders, including the spread of diseases through insects.
Such fears are not groundless, considering a recent US patent for a Toxic Mosquito Aerial release system, granted by The United States Patent and Trademark Office in 2014. The invention includes a drone which can release infected mosquitoes.
According to the patent documents, the drone is capable of delivering lethal and non-lethal toxins, including any agent that can be carried and administered by a mosquito.
The inventor of the drone for the releasing of toxic mosquitoes S. Mill Calvert has patented 42 similar military inventions for the US Army and Special forces, including stroke-inducing bullets ,in a span of just two years from 2013 to 2015. A person with such a name however does not exist in the US citizens registry. The US patent Lawyer, Louis Ventre, who filed the application, declined to comment if this name was a pseudonym and who his client actually was (the e-mails below).
Documents show a number of Pentagon projects involving insects as possible vectors of diseases in Georgia. In 2014 The Lugar Center was equipped with an insect facility and launched a project on Sand Flies in Georgia and the Caucasus. In 2014-2015 sand fly species were collected under another project “Surveillance Work on Acute Febrile Illness” and all (female) sand flies were tested to determine their infectivity rate. A third project, also including sand flies collection, studied the characteristics of their salivary glands. Sand flies carry dangerous parasites in their saliva which they can transmit to humans through a bite.
Since the start of the project on flies at the Lugar Center Georgia has been infested with sand flies. Local people complain of being bitten by these newly appeared flies while naked in their bathrooms (a fly in a bathroom on the right)
The Pentagon scientists have also performed experiments involving tropical mosquitos and ticks in Georgia. In 2016, 21 590 ticks were collected for a DNA database for future studies at The Lugar Center under the Pentagon project “Assessing the Seroprevalence and Genetic Diversity of Crimean-Congo Hemorrhagic Fever Virus (CCHFV) and Hantaviruses in Georgia”. The Pentagon projects involving ticks coincided with an inexplicable outbreak of Crimean-Congo hemorrhagic fever (CCHF) which is caused by infection through a tick-borne virus. In 2014 34 people became infected (amongst which a 4-year old child). A total of 60 cases with 9 fatalities have been registered in Georgia since 2009, according to a leaked e-mail sent by the Lugar Center director Amiran Gamkrelidze to the Minister of Health of Georgia David Sergeenko.
34 people became infected with CCHF in Georgia in 2014 alone. (Source: NCDC-Georgia)
White Powder over Chechnya
The Defense Threat Reduction Agency (DTRA), which runs the US military program at the Lugar Center in Georgia, is alleged to have already performed field tests with an unknown substance in Chechnya, Russia. In June 2017 local citizens reported on a drone disseminating white powder close to the Russian border with Georgia.
A local resident from a village in Chechnya close to the Russia-Georgia border shows traces of white powder on his car, which he says is regularly spread in the area.
The Pentagon does have drones for powder dissemination of biological agents, according to information obtained from the US Federal contracts registry. Such field tests involving drones for bio-agent dispersion have been performed since 2012 at Dugway Proving Ground, Utah. The military facility not only produces live bio agents which includes anthrax, botulinum toxin, tularemia, etc. under the pretext of studying them, but also disseminates them though aerosol, powder and explosives, as proven in a 2012 US Army Report.
An offer for commercial work by the US Army – field tests involving bio-agents and drones can be found published on a US federal contracts website.
US Army documents and photos show that the Pentagon has developed various dissemination methods for bioterrorism attacks including by explosives.
Source: Capabilities Report 2012, West Desert Test Center
Dissemination of contaminants for biological/chemical tests (©Dugway Proving Ground)
Dissemination of simulants by explosives. (©Dugway Proving Ground)
Liquid Dissemination (©Dugway Proving Ground)
Powder Dissemination (©Dugway Proving Ground)
Dissemination on the test grid (© Dugway Proving Ground)
Besides having various military capabilities to disperse bio agents, DTRA has also full access to the Russian borders, granted under a military program called Georgia Land Border Security Project. The activities, related to this project have been outsourced to a private American company – Parsons Government Services International. Parsons has been awarded a $17.7 million contract under the Pentagon border security project in Georgia. DTRA has previously contracted Parsons for similar border security projects in Lebanon, Jordan, Libya and Syria. Interestingly, a subcontractor working on this border security project – TMC Global Professional Services, also happens to be contracted by DTRA for scientific support at the Lugar Center. The same American company – TMC, which works at the Lugar Center also carries out surveillance for WMD on the Georgian borders. The project coincides with the incident involving powder dissemination which was reported and filmed in neighbouring Chechnya close to the Georgian border.
Private contractors
The Defense Threat Reduction Agency (DTRA) has outsourced much of the work under the military program to private companies, which are not accountable to Congress, and which can operate more freely and move around the rule of law.
This e-mail for instance, dated 16 February 2018, was sent by an employee of the private Contractor, TMC Global Professional Services, on behalf of the Pentagon unit at the Lugar Center, to ask for a meeting with the Georgian Minister of Health.
TMC was awarded a $3.8 million contract in 2016 running until 2021 for support services at the Lugar Center. Interestingly, the same year the same private company was awarded another $975 million counter narcoterrorism contract by the Pentagon. Why has a company, which works for the Pentagon on a program to counter narcotics, been concurrently given work at a military laboratory which burns chemicals at night?
Leaked documents reveal another company involved in the program in Georgia – Booz Allen Hamilton.
In June 2013, Edward Snowden — at the time a Booz Allen employee contracted to projects of the National Security Agency (NSA) — publicly disclosed details of the classified mass surveillance and data collection programs of the US around the world.
Snowden’s former employer – Booz Allen Hamilton, has been awarded five lucrative contracts by the Defense Threat Reduction Agency (DTRA) since 2010 running until 2022, totaling at least $ 358 million for intelligence support and chemical weapons agents support services. According to the company’s website it has developed a web-based platform for the Defense Threat Reduction Agency (DTRA) and the US intelligence community. The system currently holds more than 9 terabytes of intelligence data and grows by about 1.5 million records every week.
The Pentagon has spent at least $161 million on the Lugar Center in Tbilisi under a contract with the private American contractor – CH2M Hill. This is half of the total sum of $ 361.4 million that the company had been awarded to operate Pentagon bio-laboratories in Georgia, Uganda, Tanzania, Iraq, Afghanistan and South East Asia.
According to CH2M Hill, the US company has secured biological agents and employed former bio warfare scientists at The Lugar Center. These are scientists who are working for another American company involved in the military program in Georgia – Battelle Memorial Institute.
Battelle as a $59 million subcontractor at the Lugar Center has extensive experience in research on bio-agents, as the company has already worked on the US Bio-weapons Program under 11 previous contracts with the US Army in the past. Source: US Army Activities in the US, Biological Warfare Programs, vol. II, 1977, p. 82
The same company also worked for the CIA under the Project Clear Vision (1997-200) Its stated goal was to reconstruct a Soviet-era anthrax bomblet in order to test its dissemination characteristics. The clandestine CIA-Battelle operation was omitted from the US Biological Weapons Convention declarations submitted to the UN.
The inauguration of the Lugar Center in Tbilisi in 2011. Andrew C. Weber (on the right) –then US Assistant Secretary of Defense (2009-2014), US DoD Deputy Coordinator for Ebola Response (2014-2015), is currently a Metabiota ( the US contractor) employee.
The US Company Metabiota Inc. has been awarded $23.9 million in federal contracts under the Pentagon’s DTRA program in Georgia and Ukraine for scientific and technical consulting services. Metabiota had been contracted to perform work for DTRA befor and during the Ebola crisis in West Africa and was awarded $3.2 million (2012-2015) for work in Sierra Leone at the epicenter of the Ebola outbreak.
Metabiota worked on a Pentagon’s project at the epicenter of the Ebola crisis, where three US biolabs are located.
Journalist expelled from the European Parliament for confronting US official on bioweapons
I asked US Assistant Secretary of Health Robert Kadlec for a comment during a conference on biological weapons at the European Parliament in Brussels and was immediately expelled from the conference.
Ethnic Bioweapons
Documents reveal some of the projects funded by the Pentagon. Among them projects related to Russia. The US Air Force has been specifically collecting Russian RNA and synovial tissue samples raising fears in Moscow of a covert US ethnic bio-weapons program.
Source: fbo.gov
The Pentagon has also studied the Russian Anthrax Strain at the Lugar Center for which Russia has a vaccine, a Russian Yersinia pestis Strain (which causes plague), as well as the Genome sequence of the Russian Crimean-Congo hemorrhagic fever virus strain.
According to the genome study, the Russian “DNA is available from Dr. Mikeljon Nikolich”. He is one of the Pentagon scientists at the Lugar Center and is tasked with genome research on strains in pathogen collections from former Soviet Union countries, as a leaked document (below) reveals.
In 2017 Pentagon scientists sequenced the genome of a Russian strain of Crimean Congo Hemorrhagic Fever (CCHF).
Leaked e-mails, between the director of the Lugar Center Amiran Gamkrelidze and the Minister of Health of Georgia David Sergeenko, also reveal an ongoing Pentagon project on Crimean Congo Hemorrhagic fever in the country.
Georgians used as laboratory rabbits
The minister’s e-mails also reveal another American project on Hepatitis C in Georgia including cases of death. The pilot study of the US Center for Disease Control in Georgia is called “Simplified Diagnostics and Monitoring of Hepatitis C Infected Patients in Rural Primary Care Settings Using Newly Approved Pan-Genotypic Antiviral Therapy”. It is designated as confidential information. The Ministry of Health of Georgia has signed an Agreement with the US Center for Disease Control and the private American pharmaceutical company Gilead. According to this agreement, the American side provides free medicines for Hepatitis C treatment. In exchange, the private American company cannot be held accountable for any damage (intentional or not) which may result from the program. The agreement is signed by David Sergeenko from the Georgian side.
Minister of Health of Georgia David Sergeenko in a Gilead drugs advertisement promoting the success of the program. (©Gilead)
Minister David Sergeenko has signed an agreement with Gilead which absolves the private American pharmaceutical company of any investigation – meaning that Gilead cannot be held accountable for any damage (intentional or not) which may result from the program.
From Paris with love
Leaked e-mails between minister Sergeenko and the US Center for Disease Control (CDC) which supports the program on Hepatitic C in Georgia reveal private meetings in Paris between the government officials and Gilead.
Confidential reports: At least 100 death cases in Georgia
Leaked confidential documents show at least 100 deaths reported to Gilead, over the last 3 years, of patients under treatment with the Gilead drugs Sovaldi and Harvoni which had been provided to them for free.
Georgians have been used as laboratory rabbits for a new Hepatitis C experimental treatment by the private American company along with the US Center for Disease Control. Moreover, in some of the death cases reports sent to Gilead from the Georgian Ministry of Health the cause of death is indicated as unknown or not related to the treatment. 30 Georgians died during the drug clinical trials in December 2015 alone. Another 30 death cases were reported in April 2016, also in the span of only a month. It is worth noting that the drugs are neither emergency resuscitation drugs for patients in clinical death condition, nor cancer palliative drugs. Most causes of death remain obscure and some diagnoses do not correlate with the International Classification of Diseases by WHO.
A discrepancy in a 2017 death case report from the Georgian Ministry of Health to Gilead raises questions – how can a dead patient continue his treatment after his death?
30 cases of death were reported in April 2016 alone. According to the reports, however, the cause of death was not linked to the treatment or was unknown.
30 cases of death were reported in April 2016 alone. According to the reports, however, the cause of death was not linked to the treatment or was unknown.
To make things worse, the US government agency has launched the ostensibly altruistic project on free medicines for the poor Georgian people in partnership with the private American company Gilead thus being in direct conflict of interest. A financial report for 2017 reveals that the same company Gilead is among the main sponsors of the Center for Disease Control Foundation.
The biggest shareholder in Gilead is the former US Minister of Defense Donald Rumsfeld.
On 5 September 2018, the Anticorruption Department of the Georgian National Security Agency announced that it had launched an investigation into the Hepatitis C program.
The US-funded Lugar Center in Tbilisi may have been involved in illegal experiments on Georgian citizens, the country’s former security minister Igor Giorgadze has claimed, citing leaked documents he obtained. He said he managed to acquire over 100,000 pages of documents about the research done at the Richard Lugar Center.
The minister of Health of Georgia David Sergeenko did not respond to my questions. The leaked e-mails though show the minister’s reaction
xxxxxxxxxx
ForebiddenKnowlege
ForbiddenKnowledge
In this video, George Webb cements Buttigieg’s status as a covert operator who was directly involved in the Deep State’s rape and pillage of the Middle East during the Obama Administration, combining his own research efforts with those of Harry “The Greek” at Brassballs.blog. The latter has been reporting that Pete Buttigieg is the CIA’s pick for next President of the US and he documents his links to the Afghanistan heroin network.
It is confirmed in Pete Buttigieg’s military record that he was deployed from 2009 to 2017 as a “counterintelligence” spy in the Navy Reserve and CIA.
While Deep State Pete admits to serving 7 months of 2014 in Afghanistan during his tenure as Mayor of South Bend, Indiana (January 1, 2012 – January 1, 2020), the Navy has confirmed he served an additional 36 months, plus he was deployed “in Africa and former Yugoslavia” from February 1st, 2010 to May 31st, 2010.
Buttigieg worked in a NATO unit called the Afghanistan Threat Force Cell (ATFC). The ATFC is a “joint Treasury, State and Defense Department initiative to identify and help disrupt the material and financial funding streams that were supporting the Taliban and other terrorist organizations”.
Buttigieg was involved in tracking drug money to and from Afghanistan, which grows 90% of the world’s poppies used for heroin.
Kirk Meyer was former Director of the Afghanistan Threat Finance Cell (ATFC), which he called a massive “money laundering operation”.
According to Meyer, Hillary Clinton and the State Department were responsible for the graft. A typical payoff was 20% of every development project. Another 25% of every project went to the Taliban.
The Inspector General’s report from two weeks ago on Afghanistan cited these examples. Since 2002:
-$776 billion went for “the war”
-$137 billion went for “reconstruction”.
– $10 billion was left over.
– What was Pelosi’s share? She made an unannounced trip to Afghanistan last October to meet with President Ashraf Ghani to find out.
(How much will end up in Deep State Pete’s Campaign for President?)
***
George Webb claims that, owing to his superior Farsi language skills, Buttigieg likely helped in the negotiation of the Obama Administration’s Iran nuclear deal, alongside Peter Strzok, with whom he spent 42 months, partly in the Somaliland-Kenya area.
Webb asks, “Why is [Buttigieg] so being pushed forward as a presidential candidate? Because he got the gold star, he got the coin…he did a good job for Libya, that was very successful. Syria, of course failed. Sudan was successful. Yemen, sort-of quasi-successful.
“The other person this maps to, as far as [digital telecom] footprints go is Cofer Black. Again, you take the weapons from one theater of action, which is Afghanistan – this is where Peter Buttigieg is supposed to be but he’s over there, in the Horn of Africa.
“You take the other person, who’s supposed to be in Iraq, with the reconstruction of Iraq, which is the Vindmans and Paul Wellen and they’re also seemingly sending and diverting weapons to Africa.
“You put the two together and you have the story of Libya, Syria and all the weapons diversion; the NATO weapons from both the Iraq theater of war, as well as the AfPak theater of war.
“Pete Buttigieg – again, the [cellphone] metadata it’s gonna say that the diversion of weapons, the diversion of money happened in this AfPak Center of Excellence from MacDill Air Force Base. That $100 million that was created by David Petraeus, that’s what got diverted to Africa.
“That’s those phones; those Imran Awan phones or Haqqani network phones – whatever you want to call them – Teneo phones…Burisma phones – those are the phones [that are undetectable by NSA] that are gonna be used to negotiate all these things like the Iran nuclear deal.
“And again, where is the precedent that this happened? Well, all these same programs used to be overt programs, they were just made covert. Atoms for Peace Program – again, based in Fort Belvoir. The only thing they did was they hid it from the President, basically squirreled the files away and then kept running all those programs as a covert action.
“Who was the key recipient, who was the first country, really to be a part of the of this Atoms for Peace? None other than Iran. The legacy here is long, with Atoms for Peace, all the way from the first days with Iran.”
xxxxxxxxxxxxxx
By the Children’s Health Defense Team
ChildrensHealthDefense
National and international health agencies such as the Centers for Disease Control and Prevention (CDC), the European Medicines Agency (EMA) and the World Health Organization (WHO) routinely and emphatically claim that serious adverse events following vaccination are rare. Nowhere is officialdom’s minimization of vaccine risks more apparent than in these agencies’ position on vaccine-related deaths. The WHO, for example, states that “so few deaths can plausibly be attributed to vaccines that it is hard to assess the risk statistically.” Nevertheless, once regulators have deemed that a given vaccine is safe enough to be licensed and widely marketed, vaccine manufacturers are supposed to do just that—that is, continue to statistically assess a vaccine’s risks, including the risk of death—and regulators are supposed to carefully review the postlicensure data that pharmaceutical companies submit.
…GlaxoSmithKline neglected to report to regulatory authorities that there was a statistically significant increased risk of sudden infant death in the four days after administration of its hexavalent vaccine…
A 2017 commentary by India-based physicians Jacob Puliyel and C. Sathyamala in the Indian Journal of Medical Ethics describes a shocking dereliction of duty on the part of regulators who were presented with vaccine data carefully tailored to obscure serious risks. Tackling concerns about infant deaths that have occurred following hexavalent vaccination in several European countries, the authors of the commentary show that GlaxoSmithKline (GSK) neglected to report to regulatory authorities that there was a statistically significant increased risk of sudden infant death in the four days after administration of its hexavalent vaccine—and the regulatory agency in question (the EMA) ignored the omission and accepted GSK’s apparently whitewashed data at face value.
Problematic hexavalent vaccines and problematic analyses
Among world regions, European countries have taken the lead in incorporating hexavalent vaccines into their childhood vaccine schedules. Hexavalent vaccines are potent six-in-one combination shots covering diphtheria, tetanus, pertussis, hepatitis B, polio and Haemophilus influenzae type B. In 2000, the European Union (EU) approved two hexavalent vaccines—GSK’s Infanrix hexa and Sanofi Pasteur’s Hexavac—but suspended Hexavac five years later after a detailed analysis suggested that children who received the vaccine in their second year of life had an elevated risk of sudden death. The analysis by Drs. Puliyel and Sathyamala suggests that Infanrix hexa may be just as problematic as the discredited Hexavac vaccine.
In Europe, vaccine manufacturers routinely provide the EMA with pharmacovigilance documents called periodic safety update reports (PSURs). The PSURs are intended to be critical medical analyses that evaluate “new or changing safety data,” and the EMA relies on them to make or uphold its vaccine-related policies. In its PSURs for Infanrix hexa, GSK typically compares “expected” and “observed” deaths following hexavalent vaccination. If the observed deaths were to significantly exceed the expected deaths, GSK would be forced to report “an increased risk of sudden infant death following vaccination with Infanrix hexa.”
According to Drs. Puliyel and Sathyamala, GSK’s analyses have been marred by statistical maneuvers and flawed assumptions that enable the company to mask probable risks. For example, GSK’s calculation of expected deaths relies on assumptions that overestimate expected deaths, while the company gleans its figures for observed deaths through passive surveillance reports that are not actively solicited or investigated and are notorious for underestimating the true magnitude of adverse events. In the U.S., the Food and Drug Administration (FDA) estimates that passive surveillance captures about one percent of vaccine-related adverse events. A study in Africa that compared passive with active surveillance found that passive surveillance “failed to identify half of all AEFIs [adverse events following immunization] that were identified through active surveillance, including all of the serious AEFIs.”
Reviewing and reanalyzing GSK’s sudden death data from five PSURs (numbers 15-19), Drs. Puliyel and Sathyamala start with the earliest PSUR (number 15) and note a “clustering” of sudden deaths among infants (under age one) in the first three days following vaccination—with 72% of the deaths (42/58) taking place in that time frame and nearly all (93% or 54/58) occurring within 10 days of vaccination. The authors state:
“The fact that the rate of death decreases rapidly with the passage of time following immunization suggests that the deaths could be related to vaccination.”
Turning to the 19th PSUR (which should include all cumulative deaths reported in prior PSURs), Puliyel and Sathyamala note that the numbers in number 19 are not “consistent” with the numbers in the 16th PSUR; specifically, “the cumulative deaths reported are lower in the PSUR 19 than in the PSUR 16.” After correcting the data by restoring the missing deaths, the two authors find that “the number of observed deaths is significantly higher than expected for the first four days after vaccination” [emphasis added]. They suggest that GSK owes consumers and regulators an explanation as to why it did not report this statistically significant increased risk of infant death. They also caution:
“If one glosses over the deaths after vaccination, one can prevent/delay the evaluation of the vaccine’s safety profile and this has the potential to result in more, unnecessary deaths, which is difficult to justify ethically.”
Clinical evidence on hexavalent vaccines
Italian researchers have published clinical reports that suggest a relationship between Infanrix hexa and sudden infant death. In one case report, a three-month-old female infant died within 24 hours of vaccination with Infanrix hexa due to a likely anaphylactic reaction. The authors of the study suggest that anaphylaxis may be underreported as a vaccine-related outcome, given the difficulty of pinpointing which specific vaccine components were involved and the possibility that several ingredients (i.e., vaccine antigens, animal proteins, antibiotics) could be responsible.
Another analysis looked at 13 SIDS deaths that occurred one to seven days after administration of either Hexavac or Infanrix hexa (2000-2010) and likewise speculated that “vaccine components could have a direct role in sparking off a lethal outcome in vulnerable babies.” Elaborating on possible mechanisms, the authors stated:
“…Several compounds and…adjuvants of the hexavalent vaccine might easily go beyond the BBB [blood-brain barrier], that in the first months of life is still immature and quite permeable, inducing…molecular alterations [in the brain]…with consequent fatal disorganization of respiratory control in particularly predisposed infants.”
Making safety a priority
The WHO and government health agencies are quick to dismiss as a “myth” any possible link between vaccines and sudden infant death syndrome (SIDS) or other unexplained infant deaths—despite a landmark ruling by the U.S. Court of Federal Claims in 2017 that vaccines “caused or substantially contributed” to a 2011 SIDS death. And, notwithstanding the worrisome reports of sudden infant deaths associated with hexavalent vaccines, the combination vaccines appear to be here to stay. Following Hexavac’s withdrawal from the European market, the EU has gone on to grant marketing approval to two other hexavalent vaccines manufactured by Sanofi Pasteur (Hexyon and Vaxelis, in 2013 and 2016, respectively). The EU also gave a scientific thumbs-up for rollout of Sanofi’s Hexaxim vaccine in non-EU regions.
…public health officials and agencies in low- and middle-income countries, including India, are eagerly embracing hexavalent vaccines as “the future of routine immunization,” primarily because of the six-in-one vaccines’ perceived potential to boost vaccine coverage while lowering program costs.
Outside the EU, public health officials and agencies in low- and middle-income countries, including India, are eagerly embracing hexavalent vaccines as “the future of routine immunization,” primarily because of the six-in-one vaccines’ perceived potential to boost vaccine coverage while lowering program costs. These same enthusiasts also view combination vaccines as a way to defuse the concerns of those who object that babies receive “too many shots too soon.” A 2017 study funded by Merck and Sanofi Pasteur optimistically stated that incorporation of hexavalent vaccines into the U.S. vaccine schedule “could improve coverage rates and timeliness” and “reduce the ‘shot burden.’”
Vaccine researchers at the CDC admit that there is a need to invest in vaccine safety infrastructure “at a level commensurate with investments in vaccine development,” particularly through postlicensure studies that compensate for the “well-known limitations” of prelicensure clinical trials. These CDC researchers also (somewhat understatedly) point out the “increasing emphasis…on proving, rather than assuming, that no problems are associated with a vaccine” [emphasis added]. What the commentary by Drs. Puliyel and Sathyamala shows is that the “proof” offered by vaccine manufacturers cannot be accepted uncritically and that regulatory agencies must scrutinize pharma-authored reports rather than simply rubber-stamping them. As a result of the EMA’s failure to perform due diligence on Infanrix hexa, say the two medical researchers, “numerous children were unnecessarily exposed to the risk of death
xxxxxxxxxxxxxx
Swiss Research Site: Pandemic is a Total Fraud
April 12, 2020
The author, Swiss Propaganda Research (SPR) is an independent nonprofit research group investigating geopolitical propaganda in Swiss and international media. SPR is run by independent academics and receives no external funding.
An important distinction concerns the question of whether people die with or indeed from coronaviruses. Autopsies show that in many cases the previous illnesses were an important or decisive factor, but the official figures usually do not reflect this.
- 50% to 80% of test-positive individuals remain symptom-free. Even among the 70 to 79 year old persons about 60% remain symptom-free, many more show only mild symptoms.
Published: March 14, 2020; Updated: April 7, 2020
Share on: Twitter / Facebook
Fully referenced facts about Covid-19, provided by experts in the field, to help our readers make a realistic risk assessment. (Regular updates below)
"The only means to fight the plague is honesty." Albert Camus, The Plague (1947)
Overview
- According to data from the best-studied countries such as South Korea, Iceland and Germany as well as the cruise ship Diamond Princess, the overall lethality of Covid19 is in the per mille range and thus about ten times lower than initially assumed by the WHO.
- A study in Nature Medicine comes to a similar conclusion even for the Chinese city of Wuhan. The initially significantly higher values for Wuhan were obtained because many people with mild or no symptoms were not recorded.
- 50% to 80% of test-positive individuals remain symptom-free. Even among the 70 to 79 year old persons about 60% remain symptom-free, many more show only mild symptoms.
- The median age of the deceased in most countries (including Italy) is over 80 years and only about 1% of the deceased had no serious previous illnesses. The age and risk profile of deaths thus essentially corresponds to normal mortality.
- Many media reports of young and healthy people dying from Covid19 have proven to be false upon closer inspection. Many of these people either did not die from Covid19 or they in fact had serious preconditions (such as undiagnosed leukaemia).
- Normal overall mortality in the US is about 8000 people per day, in Germany about 2600 people and in Italy about 1800 people per day. Influenza mortality in the US is up to 80,000, in Germany and Italy up to 25,000, and in Switzerland up to 1500 people per winter.
- Strongly increased death rates, as in northern Italy, can be influenced by additional risk factors such as very high air pollution and legionella contamination, as well as a collapse in the care of the elderly and sick due to infections, mass panic and lockdown.
- In countries such as Italy and Spain, and to some extent Great Britain and the US, a serious overload of hospitals, notably by the flu, is not unusual. In addition, up to 15% of doctors and nurses currently have to self-quarantine, even if they develop no symptoms.
- An important distinction concerns the question of whether people die with or indeed from coronaviruses. Autopsies show that in many cases the previous illnesses were an important or decisive factor, but the official figures usually do not reflect this.
- Thus in order to assess the danger of the disease, the key indicator is not the often mentioned number of test-positive persons and deceased, but the number of persons who actually and unexpectedly develop or die of pneumonia.
- The often shown exponential curves of "corona cases" are misleading, since the number of tests also increases exponentially. In most countries, the ratio of positive tests to total tests either remains constant between 5% to 15% or increases only very slowly.
- Countries without lockdowns and contact bans, such as Japan, South Korea and Sweden, have not experienced a more negative course of events than other countries. This might call into question the effectiveness of such far-reaching measures.
- According to leading lung specialists, invasive ventilation of Covid19 patients is often counterproductive and causes additional damage to the lungs. The invasive ventilation of Covid19 patients is partly done out of fear of spreading the virus through aerosols.
- Contrary to original assumptions, however, the WHO determined at the end of March that there is no evidence of aerosol dispersal of the virus. A leading German virologist also found no aerosol and no smear infections in a pilot study.
- Many clinics in Europe and the US have been lacking patients and some have had to introduce short-time work. Numerous operations and therapies were cancelled by clinics, even emergency patients sometimes stay at home out of fear of the virus.
- Several media have been caught trying to dramatize the situation in clinics, sometimes even with manipulative pictures and videos. In general, many media outlets do not question even doubtful official statements and figures.
- The virus test kits used internationally are prone to errors. Several studies have shown that even normal corona viruses can give a false positive result. Moreover, the virus test currently in use has not been clinically validated due to time pressure.
- Numerous internationally renowned experts from the fields of virology, immunology and epidemiology consider the measures taken to be counterproductive and recommend a rapid natural immunisation of the general population while protecting risk groups.
- The number of people suffering from unemployment, psychological problems and domestic violence as a result of the measures taken has exploded in the US and worldwide. Several experts believe that the measures may claim more lives than the virus itself.
- NSA whistleblower Edward Snowden warned that the corona crisis is used for the massive and permanent expansion of global surveillance. The renowned virologist Pablo Goldschmidt spoke of a "global media terror" and "totalitarian measures". Leading British virologist Professor John Oxford spoke of a "media epidemic".
See also: The Open Letter by Professor Bhakdi to German Chancellor Merkel.
Below you will find fully referenced updates on medical and political developments.
Scroll down to Read the April 12 Update
xxxxxxxxxxxxxxxxxx
Facts about Covid-19
https://swprs.org/a-swiss-doctor-on-covid-19/
Published: March 14, 2020; Updated: April 12, 2020
Languages: CZ, DE, EN, FR, ES, HBS, HE, HU, IT, NL, NO, PL, PT, RU, SE, SI, SK, TR
Share on: Twitter / Facebook
Fully referenced facts about Covid-19, provided by experts in the field, to help our readers make a realistic risk assessment. (Regular updates below)
“The only means to fight the plague is honesty.” Albert Camus, The Plague (1947)
Overview
According to data from the best-studied countries such as South Korea, Iceland, Germany and Denmark, the overall lethality of Covid19 is in the lower per mille range and thus up to twenty times lower than initially assumed by the WHO.
A study in Nature Medicine comes to a similar conclusion even for the Chinese city of Wuhan. The initially significantly higher values for Wuhan were obtained because a many people with mild or no symptoms were not recorded.
50% to 80% of test-positive individuals remain symptom-free. Even among the 70 to 79 year old persons about 60% remain symptom-free, many more show only mild symptoms.
The median age of the deceased in most countries (including Italy) is over 80 years and only about 1% of the deceased had no serious previous illnesses. The age and risk profile of deaths thus essentially corresponds to normal mortality.
Many media reports of young and healthy people dying from Covid19 have proven to be false upon closer inspection. Many of these people either did not die from Covid19 or they in fact had serious preconditions (such as undiagnosed leukaemia).
Normal overall mortality in the US is about 8000 people per day, in Germany about 2600 people and in Italy about 1800 people per day. Influenza mortality in the US is up to 80,000, in Germany and Italy up to 25,000, and in Switzerland up to 1500 people per winter.
Strongly increased death rates, as in northern Italy, can be influenced by additional risk factors such as very high air pollution and legionella contamination, as well as a collapse in the care of the elderly and sick due to infections, mass panic and lockdown.
In countries such as Italy and Spain, and to some extent Great Britain and the US, a serious overload of hospitals, notably by the flu, is not unusual. In addition, up to 15% of doctors and nurses currently have to self-quarantine, even if they develop no symptoms.
An important distinction concerns the question of whether people die with or indeed from coronaviruses. Autopsies show that in many cases the previous illnesses were an important or decisive factor, but the official figures usually do not reflect this.
Thus in order to assess the danger of the disease, the key indicator is not the often mentioned number of test-positive persons and deceased, but the number of persons who actually and unexpectedly develop or die of pneumonia.
The often shown exponential curves of “corona cases” are misleading, since the number of tests also increases exponentially. In most countries, the ratio of positive tests to total tests either remains constant between 5% to 25% or increases rather slowly.
Countries without lockdowns and contact bans, such as Japan, South Korea and Sweden, have not experienced a more negative course of events than other countries. This might call into question the effectiveness of such far-reaching measures.
According to leading lung specialists, invasive ventilation of Covid19 patients is often counterproductive and causes additional damage to the lungs. The invasive ventilation of Covid19 patients is partly done out of fear of spreading the virus through aerosols.
Contrary to original assumptions, however, the WHO determined at the end of March that there is no evidence of aerosol dispersal of the virus. A leading German virologist also found no aerosol and no smear infections in a pilot study.
Many clinics in Europe and the US have been lacking patients and some have had to introduce short-time work. Numerous operations and therapies were cancelled by clinics, even emergency patients sometimes stay at home out of fear of the virus.
Several media have been caught trying to dramatize the situation in clinics, sometimes even with manipulative pictures and videos. In general, many media outlets do not question even doubtful official statements and figures.
The virus test kits used internationally are prone to errors. Several studies have shown that even normal corona viruses can give a false positive result. Moreover, the virus test currently in use has not been clinically validated due to time pressure.
Numerous internationally renowned experts from the fields of virology, immunology and epidemiology consider the measures taken to be counterproductive and recommend a rapid natural immunisation of the general population while protecting risk groups.
The number of people suffering from unemployment, psychological problems and domestic violence as a result of the measures taken has exploded in the US and worldwide. Several experts believe that the measures may claim more lives than the virus itself.
NSA whistleblower Edward Snowden warned that the corona crisis is used for the massive and permanent expansion of global surveillance. The renowned virologist Pablo Goldschmidt spoke of a “global media terror” and “totalitarian measures”. Leading British virologist Professor John Oxford spoke of a “media epidemic”.
See also: The Open Letter by Professor Bhakdi to German Chancellor Merkel.
Below you will find regular, but not daily, updates on medical and political developments.
April 12, 2020
New studies
Stanford professor of medicine John Ioannidis concludes in a new study that the risk of death from Covid19 for people under 65 years of age, even in global „hotspots“, is equivalent to the risk of a fatal car accident for daily commuters driving between 9 and 400 miles.
In a serological pilot study, German virologist Hendrick Streeck comes to the interim result that the lethality of Covid19 is at 0.37% and the mortality (based on the total population) at 0.06%. These values are about ten times lower than those of the WHO and about five times lower than those of Johns Hopkins University.
A Danish study with 1500 blood donors found that the lethality of Covid19 is only 1.6 per thousand, i.e. more than 20 times lower than originally assumed by the WHO and thus in the range of a strong (pandemic) influenza. At the same time Denmark has decided to reopen schools and kindergartens next week.
A serological study in the US state of Colorado comes to the preliminary conclusion that the lethality of Covid19 has been overestimated by a factor of 5 to a factor of 20 and is likely to be in the range between normal and pandemic influenza.
A study conducted by the Medical University of Vienna concluded that the age and risk profile of Covid19 deaths is similar to normal mortality.
A study in the Journal of Medical Virology concludes that the internationally used coronavirus test is unreliable: In addition to the already known problem of false positive results, there is also a „potentially high“ rate of false negative results, i.e. the test does not respond even in symptomatic individuals, while in other patients it does respond once and then again not. This makes it more difficult to exclude other flu-like illnesses.
A Swiss biophysicist has for the first time evaluated and graphically displayed the rate of positive tests in the US, France, Germany and Switzerland. The result shows that the positive rate in these countries is increasing rather slowly and not exponentially.
Dr. Daniel Jeanmonod, emeritus Swiss professor of physiology and neurosurgery, recommends in an analysis: „Think deep, do good science, and do not panic!„
US researchers conclude that local air pollution greatly increases the risk of death from Covid19. This confirms earlier studies from Italy and China.
The WHO concluded at the end of March that, contrary to earlier assumptions, Covid19 is not transmitted by aerosols („through the air“). Transmission mainly takes place through direct contact or by droplet infection (coughing, sneezing).
The German-American epidemiology professor Knut Wittkowski argues in a new interview that the Covid19 epidemic is already declining or even „already over“ in many countries. The curfews had come too late and had been counterproductive, Wittkowski argues.
European Mortality Monitoring
European mortality monitoring now shows a clear projected excess mortality in the over-65 age group in several European countries. In some countries, however, including Germany and Austria, mortality in this age group is still in the normal range (or even below).
The question remains open as to whether the partially increased mortality is due to the coronavirus alone or also due to the sometimes drastic measures taken (e.g. isolation, stress, cancelled operations, etc.), and whether mortality will still be increased in the annual view.
Among the age groups under 65 years, so far only in England there is a projected increase in mortality beyond earlier waves of influenza. The median age of test-positive deceased is 80 in Italy, 83 in Germany and 84 in Switzerland.
Switzerland
According to the latest report of the Federal Office of Public Health, the median age of test-positive deceased is now 84 years. The number of hospitalised patients remains constant.
A study by ETH Zurich found that the infection rate in Switzerland fell to a stable value of 1 several days before the „lockdown“, presumably due to general hygiene and everyday measures. If this result is correct, it would fundamentally question the sense of a „lockdown“. (About the study)
The Swiss magazine Infosperber criticizes the information policy of authorities and the media: „Instead of informing, authorities conduct a PR campaign„. Misleading figures and graphics are used to spread at least partly unjustified fear.
The Swiss consumer protection magazine Ktipp also criticises the information policy and media reporting: „Authorities provide misleading information„.
A Swiss researcher has analysed the latest Covid19 report of the Federal Office of Public Health and comes to a very critical conclusion: the report is „scientifically unbalanced, patronising and misleading“. In consideration of the facts, the measures taken by authorities are „irresponsible and inducing fear“.
In an open letter to the Swiss Minister of Health, Swiss doctors speak of a „discrepancy between the threat scenario, which has been fuelled above all by the media, and our reality. The Covid19 cases observed in the general population were few and mostly mild, but „anxiety disorders and panic attacks“ are on the increase in the population and many patients no longer dare to come to important examination appointments. „And this in connection with a virus whose dangerousness, according to our perception, exists in Switzerland only in the media and in our heads.“
Due to the very low patient workload, several clinics in Switzerland and Germany have now had to announce short-time work. The decrease in patients is up to 80%.
The Swiss physician Dr. Paul Robert Vogt has written a highly shared article on Covid19. He criticizes a „sensationalistic press“, but also warns that this is not an „ordinary flu“. However, the physician is wrong in some points: lethality rate and median age are very much key variables, differentiation between with/by coronavirus is essential, respiratory masks and respirators are unsuitable in many cases (see below), and curfews are a questionable and possibly counterproductive measure.
Germany and Austria
In a new paper, German health experts criticise the crisis policy of the Federal Government. They speak of long-term damage to the population caused by the partial shutdown. The figures published by the RKI were „only of limited significance“.
In a statement, the Federal Association of German Pathologists demands that there must be autopsies of „corona deaths“ (in order to determine the true cause of death) and thus explicitly contradicts „the recommendation of the Robert Koch Institute“, which spoke out against autopsies, allegedly because they were too dangerous.
Dr. Martin Sprenger resigned his position in the Corona Expert Council of the Austrian Ministry of Health in order to „regain his civil and scientific freedom of opinion“. Dr. Sprenger previously criticized, among other things, that the government did not sufficiently differentiate the risk of the virus for different population groups and took too sweeping measures: „We must be careful that the loss of healthy life years due to inadequate care for other acute and chronic diseases is not a factor of 10 times higher than the loss of healthy life years caused by COVID-19“.
In a German nursing home, an 84-year-old man tested positive for Covid19, after which the entire home was quarantined and mass tests were conducted. The initial test result later turned out to be false, however.
Scandinavia
The Norwegian Medical Association writes in an open letter to the Minister of Health that they are concerned that the measures taken could be more dangerous than the virus, as normal patients are no longer being examined and treated.
A Swedish author explains in the British Spectator: „It is not Sweden that is conducting a mass experiment. It is all other countries that are doing it.“
Professor Ansgar Lohse, Director at the Hamburg University Hospital, explains in an interview: „In my opinion, the Swedish measures are the most rational in the world. Of course, the question arises whether this can be kept up psychologically. Initially, the Swedes have to reckon with significantly more deaths, but in the medium to long term these will then be significantly reduced. The bill will be paid in a year – if the Swedes can hold out. Unfortunately, the fear of the virus often forces politicians to take actions that are not necessarily reasonable. Politics is driven also by the images in the media.“
According to Swedish chief epidemiologist Anders Tegnell, Stockholm may now have reached a „plateau“ with regard to Covid infections. (More news about Sweden)
US and Asia
In the US, the authorities now also recommend that all test-positive deaths and even suspect cases without a positive test result be registered as „Covid deaths“. An American physician and state senator from Minnesota declared that this was tantamount to manipulation. Furthermore, there would be financial incentives for hospitals to declare patients as Covid19 patients. (Some humour on this topic).
A Covid19 field hospital near Seattle in Washington State was closed after only three days without admitting any patients. This is reminiscent of the hospitals built at short notice near Wuhan, which were also mostly under-utilized or even empty and were then dismantled after a short time.
Numerous media reported on alleged „corona mass graves“ on Hart Island near New York. These reports are misleading in two respects: firstly, Hart Island has long been one of the best-known „cemeteries of the poor“ in the US, and secondly the mayor of New York declared that no mass graves are planned, but that „unclaimed“ deceased (i.e. without relatives) are to be buried on Hart Island.
One of the leading Indian epidemiologists said that „We cannot run away to the moon„. He recommends the rapid development of a natural immunity in the population.
Northern Italy
Regarding northern Italy, several potential risk factors have recently been discussed.
It is true that two major vaccination campaigns against influenza and meningococcus were carried out in Lombardy in the months immediately preceding the outbreak of Covid19, notably in the later hotspots of Bergamo and Brescia. Although it is theoretically possible that such vaccinations could interact with coronavirus infections, such a possibility has not been established at present.
It is also true that a high asbestos exposure was present in northern Italy in the past, which increases the risk of cancerous lung disease. But here again, there is no direct connection with Covid19.
Nevertheless, in general it is true that the lung health of the population in northern Italy has been affected for a long time by high levels of air pollution and other detrimental factors, making it particularly susceptible to respiratory diseases.
Winter smog (NO2) in Northern Italy in February 2020 (ESA)
Swiss chief physician Pietro Vernazza
The Swiss chief physician of Infectiology, Professor Pietro Vernazza, has published four new articles on studies concerning Covid19.
The first article is about the fact that there has never been medical evidence for the efficacy of school closures, as children in general do not develop the Covid disease nor are they among the vectors of the virus (unlike with influenza).
The second article is about the fact that respiratory masks generally have no detectable effect, with one exception: sick people with symptoms (notably coughing) can reduce the spread of the virus. Otherwise the masks are rather symbolic or a „media hype“.
The third article deals with the question of mass testing. The conclusion of Professor Vernazza: „Anyone who has symptoms of a respiratory disease stays at home. The same applies to the flu. There is no added value in testing.“
The fourth article deals with the Covid19 risk groups. According to current knowledge, these include people with high blood pressure – it is suspected that the Covid19 virus uses cell receptors that are also responsible for regulating blood pressure. However, surprisingly, people with immunodeficiency and pregnant women (who naturally have a reduced immune system) are not at risk. On the contrary, the risk of Covid19 is often an overreaction of the immune system.
Intensive vs. palliative care
A German palliative physician explains in an interview that Covid19 is „not an intensive care disease“, as the severely affected people are typically people of old age who have multiple pre-existing conditions. When these people get pneumonia, they „have always been given palliative care (i.e. accompanying death)“. With a Covid19 diagnosis, however, this would now become an intensive care case, but „of course the patients still cannot be saved“.
The expert describes the current actions of many decision-makers as „panic mode“. At present, intensive care beds in Germany are still relatively empty. Respirators are free. For financial reasons, hospital managers may soon come up with the idea of admitting elderly people. „In 14 days, the wards will be full of unsalvageable, multimorbid old people. And once they are on the machines, the question arises as to who will switch them off again, as that would be a homicide.“ An „ethical catastrophe“ from greed may ensue, warns the physician.
Ventilation with Covid19
There has been and still is a worldwide rush for ventilators for Covid19 patients. This site was one of the first in the world to draw attention to the fact that invasive ventilation (intubation) may be counterproductive in many cases and may cause additional harm to patients.
Invasive ventilation was originally recommended because low oxygen levels led to the false conclusion of acute respiratory (lung) failure, and there was a fear that with more gentle, non-invasive techniques the virus could spread through aerosols.
In the meantime, several leading pulmonologists and intensive care physicians from the US and Europe have spoken out against invasive ventilation and recommend more gentle methods or indeed oxygen therapy, as already successfully used by South Korea.
Why Some Doctors Are Now Moving Away From Ventilator Treatments (TIME)
Ventilators aren’t a panacea for a pandemic like coronavirus (Dr. Matt Strauss)
With ventilators running out, doctors say the machines are overused for Covid-19
Covid-19 Does Not Lead to a “Typical” Acute Respiratory Distress Syndrome (ATSJ)
Do COVID-19 Ventilator Protocols Need a Second Look? (Medscape)
German: „Too often intubation and invasive ventilation is used“ (Dr. Thomas Voshaar)
German: COVID-19: Ventilation – and then what? (DocCheck)
Political developments
NSA whistleblower Edward Snowden warns in a new interview that governments are using the coronavirus to build an „architecture of oppression„.
Apple and Google have announced that they will work with national authorities to incorporate a so-called „contact tracing“ into their mobile operating systems, which will allow authorities to monitor contacts within the population.
German constitutional law expert Uwe Volkmann said on ARD that he knows „nobody“ among his colleagues who considers the Corona measures to be in conformity with the constitution.
The Italian government has set up a „task force“ to „eliminate“ false reports about Covid on the Internet. However, freedom of expression remains „untouched“, it was said.
France has extended, due to Covid, the permitted pre-trial detention and suspended the examination by a judge. Complaints by lawyers‘ associations were rejected.
Denmark introduced „unprecedentedly tough emergency laws“ at the beginning of April: „The health authorities can now order compulsory tests, compulsory vaccinations and compulsory treatment, and use the military and private security services in addition to the police to enforce their orders.“
The police in the German state of North Rhine-Westphalia are testing drones in „corona missions“, specifically to search for prohibited groups of people.
The German state of Saxony wants to put quarantine objectors in psychiatric hospitals.
A Swiss doctor critical of corona measures has been arrested and sent to psychiatry for „making threats against authorities and relatives“, the Swiss police said.
In Germany, an attorney in medical law has filed a constitutional complaint against the Corona measures and published an open letter on the subject, in which she warns against slipping into a police state and called for demonstrations. The public prosecutor’s office and the police then started investigations against the lawyer for „calling for a criminal offence“, and the lawyer’s website was temporarily shut down. The constitutional complaint has since been rejected.
In Austria, too, several lawyers have now lodged complaints against the Corona measures with the Constitutional Court. The lawyers argue that fundamental rights and separation of powers have been violated by the measures.
The mayor of Los Angeles promised a reward for „snitches“ who report their neighbours to the authorities if they violate the curfews.
In the US, more than 16 million people are already unemployed due to the lockdown, which is about 10% of the working population. According to the International Labor Organization, 80% of the world’s 3.3 billion workers are currently affected by the measures, and 1.25 billion workers could be affected by „drastic or catastrophic“ consequences.
Weekly new unemployment claims in the US.
April 7, 2020
The latest figures from a special report by the German Robert Koch Institute show that the so-called positive rate (i.e. the number of test positives per number of tests) is increasing much more slowly than the exponential curves shown by the media and was only around 10% at the end of March, a value that is rather typical for corona viruses. According to the magazine Multipolar, there can therefore be „no question of a dangerously rapid spread of the virus“.
Professor Klaus Püschel, head of forensic medicine in Hamburg, explains about Covid19: „This virus influences our lives in a completely excessive way. This is disproportionate to the danger posed by the virus. And the astronomical economic damage now being caused is not commensurate with the danger posed by the virus. I am convinced that the Corona mortality rate will not even show up as a peak in annual mortality.“ In Hamburg, for example, „not a single person who was not previously ill“ had died of the virus: „All those we have examined so far had cancer, a chronic lung disease, were heavy smokers or severely obese, suffered from diabetes or had a cardiovascular disease. The virus was the last straw that broke the camel’s back, so to speak. „Covid-19 is a fatal disease only in exceptional cases, but in most cases it is a predominantly harmless viral infection.“
In addition, Dr. Püschel explains: „In quite a few cases, we have also found that the current corona infection has nothing whatsoever to do with the fatal outcome because other causes of death are present, for example a brain haemorrhage or a heart attack. Corona in itself is a „not particularly dangerous viral disease“, says the forensic scientist. He pleads for statistics based on concrete examination results. „All speculations about individual deaths that have not been expertly examined only fuel anxiety.“ Contrary to the guidelines of the Robert Koch Institute, Hamburg had recently started to differentiate between deaths „with the“ and „by the“ coronavirus, which led to a decrease in Covid19 deaths.
The German virologist Hendrik Streeck is currently conducting a pilot study to determine the distribution and transmission routes of the Covid19 pathogen. In an interview he explains: „I took a closer look at the cases of 31 of the 40 people who died in the Heinsberg district – and was not very surprised that these people died. One of the deceased was older than 100 years, so even a common cold could have led to death.“ Contrary to original assumptions, Streeck has not been able to prove transmission via door handles and the like (i.e. so-called smear infections).
The first Swiss hospitals have to announce short-time work due to the very low capacity utilization: „The staff in all departments has too little to do and has reduced overtime in a first step. Now short-time work is also being registered. The financial consequences are severe.“ As a reminder, a study by ETH Zurich based on largely unrealistic assumptions predicted the first bottlenecks in Swiss clinics by April 2. So far this has not happened anywhere.
In Switzerland, there was a pronounced wave of influenza at the beginning of 2017. At that time, there were almost 1500 additional deaths in the over 65-year-old population in the first six weeks of the year. Normally, around 1300 people die in Switzerland every year as a result of pneumonia, 95% of whom are over 65 years old. By comparison, a total of 762 deaths with (not caused by) Covid19 are currently reported in Switzerland.
The managing director of a German environmental laboratory suspects that the inhabitants of the northern Italian region of Lombardy are particularly susceptible to viral infections such as Covid19 due to a notoriously high legionella contamination: „If the lungs are weakened by a viral infection, as in the current situation, bacteria have an easy job, can negatively influence the course of the disease and cause complications.“ In Lombardy, regional pneumonia outbreaks had already occurred in the past due to evaporation cooling systems contaminated with legionella.
On the basis of information from China, medical protocols have been defined worldwide that rapidly provide invasive artificial respiration by intubation for test-positive intensive care patients. On the one hand, the protocols assume that a more gentle non-invasive ventilation through a mask is too weak, on the other hand there is the fear that the „dangerous virus“ could otherwise spread through aerosols. As early as March, however, German physicians pointed out that intubation can lead to additional lung damage and has an overall poor chance of success. In the meantime, US physicians have also come forward who describe intubation as „more harm than good“ for patients. Patients often do not suffer from acute lung failure, but rather from a kind of altitude sickness, which is made worse by artificial respiration with increased pressure. In February, South Korean physicians reported that critical Covid19 patients respond well to oxygen therapy without a ventilator. The US physician mentioned above warns that the use of ventilators must be urgently reconsidered in order not to cause additional damage.
The official US Covid19 projections so far have overestimated hospitalisations by a factor of 8, ICU beds needed by a factor of 6.4, and ventilators needed by a factor of 40.5.
Renowned US statistician Nate Silver explains why „coronavirus case counts are meaningless„, unless you know more about the number and way of testing.
Further notes
The website of Dr. Wolfgang Wodarg, one of the earliest and internationally best known critics of the Covid19 panic, was deleted for a few hours today by the German provider Jimdo and only went online again after strong protests. It is not known whether the temporary deletion was due to general complaints or a political instruction.
The university email address of emeritus professor Dr. Sucharit Bhakdi, who wrote an Open Letter to Chancellor Angela Merkel, was deactivated earlier, but was also reactivated after protests.
On April 2, the Danish Parliament adopted a new law that allows the authorities to block „fraudulent“ websites on Covid19 without an initial court order and to impose a higher penalty on the operators. It is still unclear what this means for generally critical websites about Covid19 and government policy in this regard.
The German author and journalist Harald Wiesendanger writes in an article that his profession is completely failing in the current crisis: „How a profession that is supposed to control the powerful as an independent, critical, impartial Fourth Estate can succumb as quickly as lightning to the same collective hysteria as its audience, almost unanimously, and give itself over to court reporting, government propaganda and expert deification: It’s incomprehensible to me, it disgusts me, I’ve had enough of it, I dissociate myself from this unworthy performance with complete shame.
Currently, more than one third of humanity is in a „lockdown“, which is more people than lived during the Second World War.
In the US, applications for unemployment benefits have skyrocketed to over six million (see chart), a figure unparalleled since the Great Depression of 1929.
More than one hundred human rights and civil liberties organizations warn that the world is currently sleepwalking into a surveillance state. On Twitter, the hashtag #covid19 has been partially replaced by the hashtag #covid1984.
US geostrategist Henry Kissinger writes in the Wall Street Journal, „The coronavirus pandemic will forever alter the world order.“ The U.S. must „protect“ its citizens from disease while starting „the urgent work of planning for a new epoch“.
April 5, 2020
In a 40-minute interview, the internationally renowned epidemiology professor Knut Wittkowski from New York explains that the measures taken on Covid19 are all counterproductive. Instead of „social distancing“, school closures, „lock down“, mouth masks, mass tests and vaccinations, life must continue as undisturbed as possible and immunity must be built up in the population as quickly as possible. According to all findings to date, Covid-19 is no more dangerous than previous influenza epidemics. Isolation now would only cause a „second wave“ later.
The British Medical Journal (BMJ) reports that, according to the latest data from China, 78% of new test-positive individuals show no symptoms. An Oxford epidemiologist said that these findings are „very, very important.“ He added that if the results are representative, „then we have to ask, ‘What the hell are we locking down for?’“
Dr. Andreas Sönnichsen, head of the Department of General and Family Medicine at the Medical University of Vienna and chairman of the Network for Evidence-Based Medicine, considers the measures imposed so far to be „insane“. The whole state is being paralysed just to „protect the few it could affect“.
In a world first, the Swedish government has announced that it is going to officially distinguish between deaths „by“ and deaths „with“ the coronavirus, which should lead to a reduction in reported deaths. Meanwhile, for some reason, international pressure on Sweden to abandon its liberal strategy is steadily increasing.
The Hamburg health authority now has test-positive deaths examined by forensic medicine in order to count only „real“ corona deaths. As a result, the number of deaths has already been reduced by up to 50% compared to the official figures of the Robert Koch Institute.
As early as 2018, the German Doctors Journal reported a „multitude of pneumonia cases“ in northern Italy, which worried the authorities. At the time, contaminated drinking water was suspected to be one of the causes.
The German Pharmaceutical Newspaper points out that in the current situation, patients often „fall seriously ill, even die, without having developed respiratory symptoms beforehand“. Neurologists suspect in this regard that the corona viruses could also damage nerve cells. Another explanation, however, would be that these patients, who are often in need of care, die due to the very high stress.
According to the latest figures from Switzerland, the most common symptoms of test-positive patients in hospitals are fever, cough and breathing difficulties, while 43% or about 900 people have pneumonia. Even in these cases, however, it is not a priori clear whether it was caused by the coronavirus or by other pathogens. The median age of the test positive deceased is 83 years, the range reaches up to 101 years.
The British project „In Proportion“ tracks mortality „with“ Covid19 in comparison to influenza mortality and all-cause mortality, which in Great Britain is still in the normal range or below and is currently decreasing.
In the US state of Indiana, calls to the mental health and suicide hotline have increased by over 2000% from 1000 to 25,000 calls per day due to the lockdown and its economic impact.
The medical specialist portal Rxisk points out that various drugs can increase the risk of infection with corona viruses by up to 200% in some cases.
Further notes
The British journalist Peter Hitchens describes in an article entitled „We love Big Brother“ how even previously critical people were „infected by fear“ despite the lack of medical evidence. In an interview, he explains that criticism is „a moral duty“ as fundamental rights are under threat
The German historian René Schlott writes about the „Rendezvous with the police state„: „Buying a book, sitting on a park bench, meeting up with friends – that is now forbidden, is controlled and denounced. The democratic safeguards seem to be blown. Where and how will it end?“
Several German law firms are preparing lawsuits against the measures and regulations that have been issued. A specialist in medical law writes in a press release: „The measures taken by the federal and state governments are blatantly unconstitutional and violate a multitude of basic rights of citizens in Germany to an unprecedented extent. This applies to all corona regulations of the 16 federal states. In particular, these measures are not justified by the Infection Protection Act, which was revised in no time at all just a few days ago. () Because the available figures and statistics show that corona infection is harmless in more than 95% of the population and therefore does not represent a serious danger to the general public.“
The Open Letter from Professor Sucharit Bhakdi to Chancellor Angela Merkel is now available in German, English, French, Spanish, Russian, Turkish, Dutch and Estonian, other languages will follow.
In a new interview, NSA whistleblower Edward Snowden warns that Covid19 is dangerous but temporary, while the destruction of fundamental rights is deadly and permanent.
April 3, 2020
USA: Videos by citizen journalists show that in some hospitals described by US media as „war zones“, it is in fact still very quiet. (Note: Some authors draw unverified or false conclusions.)
Austria: In Austria, too, „corona deaths“ are apparently defined „very liberally“, as the media report: „Do you also count as a corona death if you are infected with the virus but die of something else? Yes, say Rudi Anschober and Bernhard Benka, members of the Corona Task Force in the Ministry of Health. „There is a clear rule at present: Died with the corona virus or died from the corona virus both count for the statistics.“ No difference is made as to what the patient actually died of. In other words, a 90-year-old man who dies with a fracture of the femoral neck and becomes infected with corona in the hours prior to his death is also counted as corona death. To name but one example.“
Germany: The German Robert Koch Institute now advises against autopsies of test-positive deceased persons because the risk of droplet infection by aerosols is allegedly too high. In many cases, this means that the real cause of death can no longer be determined.
A specialist in pathology comments on this as follows: „Who might think evil of it! Up to now, it has been a matter of course for pathologists to carry out autopsies with appropriate safety precautions even in the case of infectious diseases such as HIV/AIDS, hepatitis, tuberculosis, PRION diseases, etc. It is quite remarkable that in a disease that is killing thousands of patients all over the world and bringing the economy of entire countries to a virtual standstill, only very few autopsy findings are available (six patients from China). From the point of view of both the epidemic police and the scientific community, there should be a particularly high level of public interest in autopsy findings. However, the opposite is the case. Are you afraid of finding out the true causes of death of the positively tested deceased? Could it be that the numbers of corona deaths would then melt away like snow in the spring sun?“
Italy: Russian experts have noticed „strange deaths“ in nursing homes in Lombardy: „According to newspaper reports, several cases have been registered in the town of Gromo in which alleged corona virus-infected persons simply fell asleep and never woke up again. No real symptoms of the disease had been observed in the deceased until then. () As the director of the nursing home later clarified in an interview with RIA Novosti, it is unclear whether the deceased were actually infected with the coronavirus, because nobody in the home had been tested for it. () In the homes, where medical and nursing teams from Russia are working, corridors, bed rooms and dining rooms are disinfected.“
Similar cases have already been reported from Germany: Nursing patients without symptoms of illness die suddenly in the current exceptional situation and are then considered „corona deaths“. Here again the serious question arises: Who dies from the virus and who dies from the sometimes extreme measures?
Nursing staff: The Süddeutsche Zeitung reports: „Throughout Europe, the pandemic is endangering the care of elderly people at home because nursing staff can no longer visit them – or have left the respective country in a hurry to return home.“
Lastly: Stanford professor of medicine Dr. Jay Bhattacharya gave a half-hour interview in which he questions the „conventional wisdom“ regarding Covid19. The existing measures had been decided on the basis of very uncertain and partly questionable data.
April 2, 2020 (I)
USA
A Swiss biophysicist has visualized the fact that in the US (as in the rest of the world), it is not the number of „infected“ people that is increasing exponentially, but the number of tests. The number of test-positive people in relation to the number of tests remains constant or increases slowly.
Number of positive and negative tests (left) and percantage of positive tests (right) (Scholkmann, US data)
Germany
According to the latest influenza report of the German Robert Koch Institute, the number of acute respiratory diseases has „fallen sharply nationwide“. The values have „dropped in all age groups“.
By March 20, the total number of inpatient cases with acute respiratory diseases had also fallen significantly. In the age group from 80 years and older, the number of cases had almost halved compared to the previous week.
In the 73 hospitals examined, 7% of all cases with respiratory diseases were diagnosed with COVID-19. In the age groups 35-59 years it was 16% and in the age group 60-79 years it was 13% who received a COVID-19 diagnosis.
These figures correspond to those from other countries as well as to the typical prevalence of coronaviruses (5 to 15%).
Grippeähnliche Erkrankungen (RKI, KW13)Akute Atemwegserkrankungen in Krankenhäusern
Flu-like diseases in general (left) and acute respiratory diseases in hospitals (right) (Robert-Koch-Institut, weeks 13 and 12)
An article in DIE ZEIT discusses the issue of intensive care patients in Germany:
„At present politicians, experts and many citizens observe with concern the exponentially increasing number of people who are newly infected every day. However, this is not the decisive indicator for assessing how badly the corona crisis is and will hit Germany. For it is distorted above all by the number of tests, which have been increasing for weeks.
In order to measure the burden on the health system, the number of those who are so seriously ill that they need to be ventilated is particularly important. As long as there are enough ventilation places for them, a great many of them can be saved. Only when these beds become scarce does a situation like the one in Italy threaten.
The DIVI register now shows that the situation in the German intensive care units has been relaxed so far. „We are still in a comfortable area,“ says Grabenhenrich. The number of seriously ill patients is not rising as steeply as the number of infected patients and even if it did, it would still be possible to provide a large number of intensive care beds with very good equipment.
Switzerland
The Swiss Federal Office of Public Health reports that approximately 139,330 Covid19 tests have been carried out so far, of which the result was positive in 15% of cases. This number also corresponds to the typical corona virus value known from other countries and, as far as can be seen, does not seem to be increasing rapidly in Switzerland either.
Only the number of tests often mentioned in the media is increasing exponentially, but not the number of „infected“, sick or even dead.
On March 31, however, a new weekly mortality statistic was published which for the first time forecasts an increase in overall mortality in the 65+ age group in Switzerland for the 12th calendar week (until 22 March) (see chart below). Specifically, total mortality is expected to increase by around 200 deaths per week.
According to the Federal Office, this increase is „an expression of the current pandemic“. The following problem arises here: up to 22 March there were a total of 106 test-positive deaths in Switzerland. An increase of 200 deaths per week would mean that a large part of the additional mortality is not caused by the virus but by the „countermeasures“.
Another explanation would be that the approximately 200 test-positive deaths of the following week (week 13) have already been included. This would mean that all test-positive deaths are assumed to be additional deaths. However, in view of the age and disease profile as well as international experience, this would be a very doubtful assumption.
In fact, the report adds the following disclaimer: „These initial estimates are still very uncertain, so that no exact figures can be published“.
If it turns out that a large proportion of test-positive deaths (median age: 83 years) are not additional deaths, either the overall mortality would not be increased, or it would be increased mainly because of the drastic measures, as some experts fear.
Weekly mortality until 22 March 2020 (BFS, data status 31 March 2020)
A Swiss newspaper has presented the current total mortality in comparison with previous years (see graph below). This illustrates that, even if actually increased, the current mortality rate is still below the stronger flu winters of recent years.
Weekly mortality during the year. End date is March 22, not March 31 (TA)
Further information
Virus test kits destined for Great Britain had to be recalled because they already contained corona virus components.
The British Imperial College study, which predicted hundreds of thousands of additional deaths but was never published in a journal or reviewed, was based on largely unrealistic assumptions, as has now been shown.
The BBC asks, „Is coronavirus causing the deaths?„, and replies, „It could be the major cause, a contributory factor or simply present when they are dying of something else.“ For example, an 18-year-old man was reported as the „youngest Corona victim“ after a positive test the day before his death. However, the hospital later reported that the young man had died of a serious pre-existing condition.
The European health authority ECDC has published very strict guidelines for handling test-positive or „presumed test-positive“ corpses. In view of the very low mortality rates to date, such guidelines appear questionable from a medical point of view; however, they significantly increase the burden on the health and funeral services, and at the same time have a high media impact.
A German state media outlet has published a critical commentary on Professor Sucharit Bhakdi’s Open Letter to Chancellor Merkel.
The ARTE documentary „Profiteers of Fear“ from 2009 shows how the mainly privately financed WHO „upgraded“ a mild wave of influenza (the so-called „swine flu“) to a global pandemic so that vaccines worth several billion dollars could be sold to governments around the world. Some of the protagonists of that time are again prominently represented in the current situation.
The former judge at the British Supreme Court, Jonathan Sumption, declared in a BBC interview on the British measures: „This is what a police state is like“.
April 2, 2020 (II)
Already in 2018, the Guardian wrote that „Pollution and flu bring steep rise in lung-related illnesses„: Shortage of specialists adds to worries that surge in respiratory diseases is putting pressure on A&Es.
Professor Martin Haditsch, specialist in microbiology, virology and infection epidemiology, sharply criticises the Covid19 measures. These are „completely unfounded“ and would „trample on sound judgment and ethical principles“.
Even representatives of German nursing homes are now complaining about the restrictive measures and inappropriate media coverage of Covid19: „Even before the coronavirus in the winter months, it often happened that many guests died in a relatively short time, but the television crew did not stand behind the door and did not show people in protective suits heroically exposing themselves to the risk of infection.“
Figures from the northern Italian city of Treviso (near Venice) show that, despite 108 test-positive deaths by the end of March, overall mortality in municipal hospitals remained roughly the same as in previous years. This is a further indication that the temporarily increased mortality in some places is more likely to be due to external factors such as panic and collapse than due to the coronavirus alone.
Professor John Oxford of Queen Mary University London, one of the world’s leading virologists and influenza specialists, comes to the following conclusion regarding Covid19: „Personally, I would say the best advice is to spend less time watching TV news which is sensational and not very good. Personally, I view this Covid outbreak as akin to a bad winter influenza epidemic. In this case we have had 8000 deaths this last year in the ‘at risk’ groups viz over 65% people with heart disease etc. I do not feel this current Covid will exceed this number. We are suffering from a media epidemic!“
April 1, 2020
On the situation in Italy
Italian doctors reported that they had already observed severe cases of pneumonia in northern Italy at the end of last year. However, genetic analyses now show that the Covid19 virus only appeared in Italy in January of this year. „The severe pneumonia diagnosed in Italy in November and December must therefore be due to a different pathogen,“ a virologist noted. This once again raises the question what role the Covid19 virus, or other factors, actually play in the Italian situation.
On March 30, we mentioned the list of Italian doctors who died „during the Corona crisis“, many of whom were up to 90 years old and didn’t actively participate in the crisis at all. Today, all years of birth on the list have been removed (see however the last archive version). A strange procedure.
We have also received the following message from an observer in Italy, who gives further details about the dramatic situation there, which is obviously due to far more than a virus:
„In recent weeks, most of the Eastern European nurses who worked 24 hours a day, 7 days a week supporting people in need of care in Italy have left the country in a hurry. This is not least because of the panic-mongering and the curfews and border closures threatened by the „emergency governments“. As a result, old people in need of care and disabled people, some without relatives, were left helpless by their carers.
Many of these abandoned people then ended up after a few days in the hospitals, which had been permanently overloaded for years, because they were dehydrated, among other things. Unfortunately, the hospitals lacked the personnel who had to look after the children locked up in their apartments because schools and kindergartens had been closed. This then led to the complete collapse of the care for the disabled and the elderly, especially in those areas where even harder „measures“ were ordered, and to chaotic conditions.
The nursing emergency, which was caused by the panic, temporarily led to many deaths among those in need of care and increasingly among younger patients in the hospitals. These fatalities then served to cause even more panic among those in charge and the media, who reported, for example, „another 475 fatalities“, „The dead are being removed from hospitals by the army“, accompanied by pictures of coffins and army trucks lined up.
However, this was the result of the funeral directors‘ fear of the „killer virus“, who therefore refused their services. Moreover, on the one hand there were too many deaths at once and on the other hand the government passed a law that the corpses carrying the coronavirus had to be cremated. In Catholic Italy, few cremations had been carried out in the past. Therefore there were only a few small crematoria, which very quickly reached their limits. Therefore the deceased had to be laid out in different churches.
In principle, this development is the same in all countries. However, the quality of the health system has a considerable influence on the effects. Therefore, there are fewer problems in Germany, Austria or Switzerland than in Italy, Spain or the USA. However, as can be seen in the official figures, there is no significant increase in the mortality rate. Just a small mountain that came from this tragedy.“
Hospital situation in the US, Germany and Switzerland
The US television station CBS was caught using footage from an Italian intensive care unit in a piece on the current situation in New York.
Contrary to media reports, the register of German intensive care units also shows no increased occupancy. An employee of a Munich clinic explained that they had been „waiting for weeks for the wave to hit“, but that there was „no increase in patient numbers“. He said that the politicians‘ statements did not correspond with their own experience, and that the „myth of the killer virus“ could „not be confirmed“.
Also in Swiss clinics, no increased occupancy has been observed so far. A visitor to the cantonal hospital in Lucerne reports that there is „less activity than in normal times“. Entire floors have been closed for Covid19, but staff „are still waiting for patients“. The hospitals in Bern, Basel, Zug and Zurich have also been „emptied“. Even in Ticino, the intensive care units are not working to capacity, but patients are now being transferred to other parts of the country. From a purely medical point of view, this makes little sense.
Other medical notes
The director of the University Medical Center Hamburg, Dr. Ansgar Lohse, demands a quick end to curfews and contact bans. He argues that more people should be infected with corona. Kitas and schools should be reopened as soon as possible so that children and their parents can become immune through infection with the corona virus. The continuation of the strict measures would lead to an economic crisis, which would also cost lives, said the physician.
In Spain, 15% of test-positives are doctors and nurses. Although many of them show no symptoms, they have to go into quarantine, causing the Spanish healthcare system to collapse.
Dr. John Lee, professor emeritus of pathology, is writing about the highly misleading definition and communication of „corona deaths“ in the British Spectator.
The latest data from Norway, evaluated by a PhD in environmental toxicology, again show that the rate of test-positives does not increase – as would be expected in the case of an epidemic – but fluctuates in the normal range for coronaviruses between 2 and 10%. The average age of the test-positive deceased is 84 years, the causes of death are not publicly reported, and there is no excess mortality.
Sweden, which has so far managed without radical measures and has not reported increased mortality (similar to Asian countries such as Japan or South Korea), is remarkably put under pressure from the international media to change its strategy.
Data from New York State show that the hospitalization rate of test-positive individuals could be more than twenty times lower than originally assumed.
An article on the specialist portal DocCheck deals with the problem of ventilating test-positive patients. In test-positive patients, simple ventilation through a mask is officially advised against, among other things to prevent the coronavirus from spreading through aerosols. Therefore, test positive intensive care patients are often intubated directly. However, intubation has poor chances of success and often leads to additional damage to the lungs (so-called ventilator-induced lung damage). As with medication, the question arises as to whether a more gentle treatment of patients would not be medically more sensible.
Reports on political developments
A German state minister has called on the population to „be vigilant and report violations of the rules for containing the corona epidemic to the police“. „Eagerly reported“ are, for example, „prohibited group formation, children in playgrounds, parties“ and hikers.
German constitutional law experts are raising the alarm for „serious encroachments on fundamental rights“. Constitutional law expert Hans Michael Heinig warns that the „democratic constitutional state could turn into a fascist-hysterical hygiene state in no time“. Professor Christoph Möllers of Berlin’s Humboldt University explains that the infection protection law „cannot serve as a basis for such far-reaching restrictions of citizens‘ rights of freedom“. According to the former president of the German Federal Constitutional Court, Hans Jürgen Papier, „emergency measures do not justify the suspension of civil liberties in favour of an authoritarian and surveillance state“.
Online petitions have been launched in several countries to end curfews and other encroachments on basic rights. At the same time, critical video contributions, even by doctors, are increasingly being deleted. In Berlin, a registered event on fundamental rights, at which the German constitution was distributed, was terminated by the police.
March 31, 2020 (I)
Dr. Richard Capek and other researchers have already shown that the number of test-positive individuals in relation to the number of tests performed remains constant in all countries studied so far, which speaks against an exponential spread of the virus and merely indicates an exponential increase in the number of tests.
Depending on the country, the proportion of test-positive individuals is between 5 and 15%, which corresponds to the usual spread of corona viruses. Interestingly, these constant numerical values are not actively communicated (or even removed) by authorities and the media. Instead, exponential but irrelevant and misleading curves are shown without context.
Such behavior, of course, does not correspond to professional medical standards, as a look at the traditional influenza report of the German Robert Koch Institute makes clear (p. 30, see chart below). Here, in addition to the number of detections (right), the number of samples (left, grey bars) and the positive rate (left, blue curve) are shown.
This immediately shows that during a flu season the positive rate rises from 0 to 10% to up to 80% of the samples and drops back to the normal value after a few weeks. In comparison, Covid19 tests show a constant positive rate in the normal range (see below).
Left: Number of samples and positive rate; right: number of detections (RKI, 2017)
Constant Covid19-positive rate using US data (Dr. Richard Capek). This applies analogously to all other countries for which data on the number of samples is currently available.
Covid19 positive rate (Dr. Richard Capek, US data)
March 31, 2020 (II)
A graphical analysis of the European monitoring data impressively shows that, irrespective of the measures taken, overall mortality throughout Europe remained in the normal range or below by March 25, and often significantly below the levels of previous years. Only in Italy (65+) was the overall mortality rate somewhat increased (probably for several reasons), but it was still below previous flu seasons.
The president of the German Robert Koch Institute confirmed again that pre-existing conditions and actual cause of death do not play a role in the definition of so-called „corona deaths“. From a medical point of view, such a definition is clearly misleading. It has the obvious and generally known effect of putting politics and society in fear.
In Italy the situation is now beginning to calm down. As far as is known, the temporarily increased mortality rates (65+) were rather local effects, often accompanied by mass panic and a breakdown in health care. A politician from northern Italy asks, for example, „how is it possible that Covid patients from Brescia are transported to Germany, while in the nearby Verona two thirds of intensive care beds are empty?“
In an article published in the European Journal of Clinical Investigation, Stanford professor of medicine John Ioannidis criticizes the „harms of exaggerated information and non-evidence-based measures“. Even journals had published dubious claims at the beginning.
A Chinese study published in the Chinese Journal of Epidemiology in early March, which indicated the unreliability of the Covid19 virus tests (approx. 50% false-positive results in asymptomatic patients), has since been withdrawn. The lead author of the study, the dean of a medical school, did not want to give the reason for the withdrawal and spoke of a „sensitive matter„, which could indicate political pressure, as an NPR journalist noted. Independent of this study, however, the unreliability of so-called PCR virus tests has long been known: In 2003, for example, a mass infection in a Canadian nursing home with SARS corona viruses was „found“, which later turned out to be common cold corona viruses (which can also be fatal for risk groups).
Authors of the German Risk Management Network RiskNET speak in a Covid19 analysis of a „blind flight“ as well as „insufficient data competence and data ethics“. Instead of more and more tests and measures a representative sample is necessary. The „sense and ratio“ of the measures must be critically questioned.
The Spanish interview with the internationally renowned Argentinian-French virologist Pablo Goldschmidt was translated into German. Goldschmidt considers the measures imposed to be medically counterproductive and notes that one must now „read Hannah Arendt“ to understand the „origins of totalitarianism“.
Hungarian Prime Minister Viktor Orban, like other prime ministers and presidents before him, has largely disempowered the Hungarian parliament under an „emergency law“ and can now govern essentially by decree.
March 30, 2020 (I)
In Germany, some clinics can no longer accept patients – not because there are too many patients or too few beds, but because the nursing staff have tested positive, although in most cases they hardly show any symptoms. This case illustrates again how and why health care systems are getting paralysed.
In a German retirement and nursing home for people with advanced dementia, 15 test-positive people have died. However, „surprisingly many people have died without showing symptoms of corona.“ A German medical specialist informs us: „From my medical point of view, there is some evidence that some of these people may have died as a result of the measures taken. People with dementia get into high stress when major changes are made to their everyday lives: isolation, no physical contact, possibly hooded staff.“ Nevertheless, the deceased are counted as „corona deaths“ in German and international statistics. In connection with the „corona crisis“, it is now also possible to die of an illness without even having its symptoms.
According to a Swiss pharmacologist, the Swiss Inselspital in Bern has forced staff to take leave, stopped therapies and postponed operations due to the fear of Covid19.
Professor Gérard Krause, head of the Department of Epidemiology at the German Helmholtz Centre for Infection Research, warns on German public television ZDF that the anti-corona measures „could lead to more deaths than the virus itself„.
Various media reported that more than 50 doctors in Italy have already died „during the corona crisis“, like soldiers in a battle. A glance at the corresponding list, however, shows that most of the deceased are retired doctors of various kinds, including 90-year-old psychiatrists and pediatricians, many of whom may have died of natural causes.
An extensive survey in Iceland found that 50% of all test-positive persons showed „no symptoms“ at all, while the other 50% mostly showed „very moderate cold-like symptoms“. According to the Icelandic data, the mortality rate of Covid19 is in the per mille range, i.e. in the flu range or below. Of the two test-positive deaths, one was „a tourist with unusual symptoms“. (More Icelandic data)
The British journalist Peter Hitchens writes, „There’s powerful evidence this great panic is foolish. Yet our freedom is still broken and our economy crippled.“ Hitchens points out that in parts of the UK, police drones monitor and report „non-essential“ walks in nature. In some cases, police drones are calling on people via loudspeaker to go home in order to „save lives“. (Note: Not even George Orwell had thought that far ahead.)
The Italian secret service warns of social unrest and uprisings. Supermarkets are already being looted and pharmacies raided.
Professor Sucharit Bhakdi has meanwhile published a video (German/English) in which he explains his Open Letter to German Chancellor Dr. Angela Merkel.
March 30, 2020 (II)
In several countries, there is increasing evidence in relation to Covid19 that „the treatment could be worse than the disease“.
On the one hand, there is the risk of so-called nosocomial infections, i.e. infections that the patient, who may only be mildly ill, acquires in hospital. It is estimated that there are approximately 2.5 million nosocomial infections and 50,000 deaths per year in Europe. Even in German intensive care units, about 15% of patients acquire a nosocomial infection, including pneumonia on artificial respiration. There is also the problem of increasingly antibiotic-resistant germs in hospitals.
Another aspect is the certainly well-intentioned but sometimes very aggressive treatment methods that are increasingly used in Covid19 patients. These include, in particular, the administration of steroids, antibiotics and anti-viral drugs (or a combination thereof). Already in the treatment of SARS-1 patients, it has been shown that the outcome with such treatment was often worse and more fatal than without such treatment.
March 29, 2020
Dr Sucharit Bhakdi, Professor Emeritus of Medical Microbiology in Mainz, Germany, wrote an Open Letter to German Chancellor Dr Angela Merkel, calling for an urgent reassessment of the response to Covid19 and asking the Chancellor five crucial questions.
The latest data from the German Robert Koch Institute show that the increase in test-positive persons is proportional to the increase in the number of tests, i.e. in percentage terms it remains roughly the same. This may indicate that the increase in the number of cases is mainly due to an increase in the number of tests, and not due to an ongoing epidemic.
The Milan microbiologist Maria Rita Gismondo calls on the Italian government to stop communicating the daily number of „corona positives“ as these figures are „fake“ and put the population in unnecessary panic. The number of test-positives depends very much on the type and number of tests and says nothing about the state of health.
Dr. John Ioannidis, Stanford Professor of Medicine and Epidemiology, gave an in-depth one-hour interview on the lack of data for Covid19 measures.
The Argentinean virologist Pablo Goldschmidt, who lives in France, considers the political reaction to Covid19 as „completely exaggerated“ and warns against „totalitarian measures“. In parts of France, the movement of people is already monitored by drones.
Italian author Fulvio Grimaldi, born in 1934, explains that the state measures currently implemented in Italy are „worse than under fascism“. Parliament and society have been completely disempowered.
March 28, 2020
A new study by the University of Oxford concludes that Covid19 may already have existed in the UK since January 2020 and that half of the population may already be immunised, with most people experiencing no or only mild symptoms. This would mean that only one in a thousand people would need to be hospitalised for Covid19. (Study)
British media reported on a 21 year old woman „who died of Covid19 without any previous illnesses“. However, it has since become known that the woman did not test positive for Covid19 and died of a heart failure. The Covid19 rumor had arisen „because she had a slight cough“.
The German media scientist Professor Otfried Jarren criticized that many media provide uncritical journalism that emphasizes threats and executive power. According to Professor Jarren, there is hardly any differentiation and real debate between experts.
March 27, 2020 (I)
Italy: According to the latest data published by the Italian Ministry of Health, overall mortality is now significantly higher in all age groups over 65 years of age, after having been below average due to the mild winter. Until March 14, overall mortality was still below the flu season of 2016/2017, but may have already exceeded it in the meantime. Most of this excess mortality currently comes from northern Italy. However, the exact role of Covid19, compared to other factors such as panic, healthcare collapse and the lockdown itself, is not yet clear.
Italy: Total mortality 65+ years (red line) (MdS / 14 March 2020)
France: According to the latest data from France, overall mortality at the national level remains within the normal range after a mild influenza season. However, in some regions, particularly in the north-east of France, overall mortality in the over-65 age group has already risen sharply in connection with Covid19 (see figure below).
France: Total mortality at national level (above) and in the severely affected Haut-Rhin department (SPF / 15 March 2020)
France also provides detailed information on the age distribution and pre-existing conditions of test-positive intensive care patients and deceased patients (see figure below):
The average age of the deceased is 81.2 years.
78% of the deceased were over 75 years old; 93% were over 65 years old.
2.4% of the deceased were under 65 years of age and had no (known) previous illness
The average age of intensive care patients is 65 years.
26% of intensive care patients are over 75 years old; 67% have previous illnesses.
17% of intensive care patients are under 65 years of age and have no previous illnesses.
The French authorities add that „the share of the (Covid-19) epidemic in overall mortality remains to be determined.“
Age distribution of hospitalized patients (top left), intensive care patients (top right), patients at home (bottom left), and the deceased (bottom right). Source: SPF / 24 March 2020
USA: Researcher Stephen McIntyre has evaluated the official data on deaths from pneumonia in the US. There are usually between 3000 and 5500 deaths per week and thus significantly more than the current figures for Covid19. The total number of deaths in the US is between 50,000 and 60,000 per week. (Note: In the graph below, the latest figures for March 2020 have not yet been fully updated, so the curve is slumping).
USA: Deaths from pneumonia per week (CDC/McIntyre)
Great Britain:
Neil Ferguson of Imperial College London now assumes that the UK has sufficient capacity in intensive care units to treat Covid19 patients.
John Lee, Professor Emeritus of Pathology, argues that the particular way in which Covid-19 cases are registered leads to an overestimation of the risk posed by Covid19 compared to normal flu and cold cases.
Other topics:
A preliminary study by researchers at Stanford University showed that 20 to 25% of Covid19-positive patients tested additionally positive for other influenza or cold viruses.
The number of applications for unemployment insurance in the US skyrocketed to a record of over three million. In this context, a sharp increase in suicides is also expected.
The first test-positive patient in Germany has now recovered. According to his own statement, the 33-year-old man had experienced the illness „not as bad as the flu“.
Spanish media report that the antibody rapid tests for Covid19 only have a sensitivity of 30%, although it should be at least 80%.
A study from China in 2003 concluded that the probability of dying from SARS is 84% higher in people exposed to moderate air pollution than in patients from regions with clean air. The risk is even 200% higher among people from areas with heavily polluted air.
The German Network for Evidence-Based Medicine (EbM) criticises the media reporting on Covid19: „The media coverage does not in any way take into account the criteria of evidence-based risk communication that we have demanded. () The presentation of raw data without reference to other causes of death leads to an overestimation of the risk“.
March 27, 2020 (II)
German researcher Dr. Richard Capek argues in a quantitative analysis that the „Corona epidemic“ is in fact an „epidemic of tests“. Capek shows that while the number of tests has increased exponentially, the proportion of infections has remained stable and mortality has decreased, which speaks against an exponential spread of the virus itself (see below).
German Virology professor Dr. Carsten Scheller from the University of Würzburg explains in a podcast that Covid19 is definitely comparable with influenza and has so far even led to fewer deaths. Professor Scheller suspects that the exponential curves often presented in the media have more to do with the increasing number of tests than with an unusual spread of the virus itself. For countries like Germany, Italy is less of a role model than Japan and South Korea. Despite millions of Chinese tourists and only minimal social restrictions, these countries have not yet experienced a Covid19 crisis. One reason for this could be the wearing of mouth masks: This would hardly protect against infection, but would limit the spread of the virus by infected people.
The latest figures from Bergamo (city) show that total mortality in March 2020 increased from typically 150 people per month to around 450 people. It is still unclear what proportion of this was due to Covid19 and what proportion was due to other factors such as mass panic, systemic collapse and the lockdown itself. Apparently the city hospital was overrun by people from the whole region and collapsed.
The two Stanford professors of medicine, Dr. Eran Bendavid and Dr. Jay Bhattacharya, explain in an article that the lethality of Covid19 is overestimated by several orders of magnitude and is probably even in Italy only at 0.01% to 0.06% and thus below that of influenza. The reason for this overestimation is the greatly underestimated number of people already infected (without symptoms). As an example, the fully tested Italian community of Vo is mentioned, which showed 50 to 75% symptom-free test-positive persons.
Dr. Gerald Gaß, President of the German Hospital Association, explained in an interview with the Handelsblatt that „the extreme situation in Italy is mainly due to the very low intensive care capacities“.
Dr. Wolfgang Wodarg, one of the early and vocal critics of a „Covid19 panic“, was provisionally excluded by the board of Transparency International Germany, where he headed the health working group. Wodarg had already been severely attacked by the media for his criticism.
NSA whistleblower Edward Snowden warns that governments are using the current situation to expand the surveillance state and restrict fundamental rights. The control measures currently put in place would not be dismantled after the crisis.
Number of tests and test-positives (proportional)Test-positives per number of tests (constant)
The increasing number of tests is finding a proportional number of infections, the ratio stays constant, speaking against an ongoing viral epidemic (Dr. Richard Capek, US data)
March 26, 2020 (I)
USA: The latest US data of March 25 shows a decreasing number of flu-like illnesses throughout the country, the frequency of which is now well below the multi-year average. The government measures can be ruled out as a reason for this, as they have been in effect for less than a week.
US Influenza Trend (March 25, 2020)US Influenza Trend (March 25, 2020)
USA: Decreasing flu-like illnesses (March 25, 2020, KINSA)
Germany: The latest influenza report of the German Robert Koch Institute of March 24 documents a „nationwide decrease in activity of acute respiratory diseases“: The number of influenza-like illnesses and the number of hospital stays caused by them is below the level of previous years and is currently continuing to decline. The RKI continues: „The increase in the number of visits to the doctor cannot currently be explained either by influenza viruses circulating in the population or by SARS-CoV-2.“
Deutschland: Atemwegserkrankungen 2019/2020 ggü. VorjahrenDeutschland: Krankenhausaufenthalte durch Atemwegserkrankungen nach Altersgruppen
Germany: Decreasing flu-like illnesses (20 March 2020, RKI)
Italy: The renowned Italian virologist Giulio Tarro argues that the mortality rate of Covid19 is below 1% even in Italy and is therefore comparable to influenza. The higher values only arise because no distinction is made between deaths with and by Covid19 and because the number of (symptom-free) infected persons is greatly underestimated.
UK: The authors of the British Imperial College study, who predicted up to 500,000 deaths, are again reducing their forecasts. After already admitting that a large proportion of test-positive deaths are part of normal mortality, they now state that the peak of the disease may be reached in two to three weeks already.
UK: The British Guardian reported in February 2019 that even in the generally weak flu season 2018/2019 there were more than 2180 flu-related admissions to intensive care units in the UK.
Switzerland: In Switzerland, the excess mortality due to Covid19 is apparently still zero. The latest „fatal victim“ presented by the media is a 100-year-old woman. Nevertheless, the Swiss government continues to tighten restrictive measures.
March 26, 2020 (II)
Sweden: Sweden has so far pursued the most liberal strategy in dealing with Covid19, which is based on two principles: Risk groups are protected and people with flu symptoms stay at home. „If you follow these two rules, there is no need for further measures, the effect of which is only marginal anyway,“ said chief epidemiologist Anders Tegnell. Social and economic life will continue normally. The big rush to hospitals has so far failed to materialize, Tegnell said.
German criminal and constitutional law expert Dr. Jessica Hamed argues that measures such as general curfews and contact bans are a massive and disproportionate encroachment on fundamental rights of freedom and are therefore presumably „all illegal“.
The latest European monitoring report on overall mortality continues to show normal or below-average values in all countries and all age groups, but now with one exception: in the 65+ age group in Italy a currently increased overall mortality is predicted (so-called delay-adjusted z-score), which is, however, still below the values of the influenza waves of 2017 and 2018.
March 25, 2020
German immunologist and toxicologist, Professor Stefan Hockertz, explains in a radio interview that Covid19 is no more dangerous than influenza (the flu), but that it is simply observed much more closely. More dangerous than the virus is the fear and panic created by the media and the „authoritarian reaction“ of many governments. Professor Hockertz also notes that most so-called „corona deaths“ have in fact died of other causes while also testing positive for coronaviruses. Hockertz believes that up to ten times more people than reported already had Covid19 but noticed nothing or very little.
The Argentinean virologist and biochemist Pablo Goldschmidt explains that Covid19 is no more dangerous than a bad cold or the flu. It is even possible that the Covid19 virus circulated already in earlier years, but wasn’t discovered because no one was looking for it. Dr. Goldschmidt speaks of a „global terror“ created by the media and politics. Every year, he says, three million newborns worldwide and 50,000 adults in the US alone die of pneumonia.
Professor Martin Exner, head of the Institute for Hygiene at the University of Bonn, explains in an interview why health personnel are currently under pressure, even though there has hardly been any increase in the number of patients in Germany so far: On the one hand, doctors and nurses who have tested positive have to be quarantined and are often hard to replace. On the other hand, nurses from neighbouring countries, who provide an important part of the care, are currently unable to enter the country due to closed borders.
Professor Julian Nida-Ruemelin, former German Minister of State for Culture and Professor of Ethics, points out that Covid19 poses no risk to the healthy general population and that extreme measures such as curfews are therefore not justified.
Using data from the cruise ship Diamond Princess, Stanford Professor John Ioannidis showed that the age-corrected lethality of Covid19 is between 0.025% and 0.625%, i.e. in the range of a strong cold or the flu. Moreover, a Japanese study showed that of all the test-positive passengers, and despite the high average age, 48% remained completely symptom-free; even among the 80-89 year olds 48% remained symptom-free, while among the 70 to 79 year olds it was an astounding 60% that developed no symptoms at all. This again raises the question whether the pre-existing diseases are not perhaps a more important factor than the virus itself. The Italian example has shown that 99% of test-positive deaths had one or more pre-existing conditions, and even among these, only 12% of the death certificates mentioned Covid19 as a causal factor.
March 24, 2020
The UK has removed Covid19 from the official list of High Consquence Infectious Diseases (HCID), stating that mortality rates are „low overall“.
The director of the German National Health Institute (RKI) admitted that they count all test-positive deaths, irrespective of the actual cause of death, as „coronavirus deaths“. The average age of the deceased is 82 years, most with serious preconditions. As in most other countries, excess mortality due Covid19 is likely to be near zero in Germany.
Beds in Swiss intensive care units reserved for Covid19 patients are still „mostly empty“.
German Professor Karin Moelling, former Chair of Medical Virology at the University of Zurich, stated in an interview that Covid19 is „no killer virus“ and that „panic must end“.
March 23, 2020 (I)
A new French study in the Journal of Antimicrobial Agents, titled SARS-CoV-2: fear versus data, concludes that „the problem of SARS-CoV-2 is probably overestimated“, since „the mortality rate for SARS-CoV-2 is not significantly different from that for common coronaviruses identified at the study hospital in France“.
An Italian study of August 2019 found that flu deaths in Italy were between 7,000 and 25,000 in recent years. This value is higher than in most other European countries due to the large elderly population in Italy, and much higher than anything attributed to Covid-19 so far.
In a new fact sheet, the World Health Organization WHO reports that Covid-19 is in fact spreading slower, not faster, than influenza by a factor of about 50%. Moreover, pre-symptomatic transmission appears to be much lower with Covid-19 than with influenza.
A leading Italian doctor reports that „strange cases of pneumonia“ were seen in the Lombardy region already in November 2019, raising again the question if they were caused by the new virus (which officially only appeared in Italy in February 2020), or by other factors, such as the dangerously high smog levels in Northern Italy.
Danish researcher Peter Gøtzsche, founder of the renowned Cochrane Medical Collaboration, writes that Corona is „an epidemic of mass panic“ and „logic was one of the first victims.“
March 23, 2020 (II)
Former Israeli Health Minister, Professor Yoram Lass, says that the new coronavirus is „less dangerous than the flu“ and lockdown measures „will kill more people than the virus“. He adds that „the numbers do not match the panic“ and „psychology is prevailing over science“. He also notes that „Italy is known for its enormous morbidity in respiratory problems, more than three times any other European country.“
Pietro Vernazza, a Swiss infectious disease specialist, argues that many of the imposed measures are not based on science and should be reversed. According to Vernazza, mass testing makes no sense because 90% of the population will see no symptoms, and lockdowns and closing schools are even „counterproductive“. He recommends protecting only risk groups while keeping the economy and society at large undisturbed.
The President of the World Doctors Federation, Frank Ulrich Montgomery, argues that lockdown measures as in Italy are „unreasonable“ and „counterproductive“ and should be reversed.
In Switzerland, despite media panic, excess mortality is still at or near zero: the latest test-positive „victims“ were a 96-year-old in palliative care and a 97-year-old with pre-existing conditions.
The latest statistical report of the Italian National Health Institute is now available in English.
March 22, 2020 (I)
Regarding the situation in Italy: Most major media falsely report that Italy has up to 800 deaths per day from the coronavirus. In reality, the president of the Italian Civil Protection Service stresses that these are deaths „with the coronavirus and not from the coronavirus“ (minute 03:30 of the press conference). In other words, these persons died while also testing positive.
As Professors Ioannidis and Bhakdi have shown, countries like South Korea and Japan that introduced no lockdown measures have experienced near-zero excess mortality in connection with Covid-19, while the Diamond Princess cruise ship experienced an extrapolated mortality figure in the per mille range, i.e. at or below the level of the seasonal flu.
Current test-positive death figures in Italy are still less than 50% of normal daily overall mortality in Italy, which is around 1800 deaths per day. Thus it is possible, perhaps even likely, that a large part of normal daily mortality now simply counts as „Covid19“ deaths (as they test positive). This is the point stressed by the President of the Italian Civil Protection Service.
However, by now it is clear that certain regions in Northern Italy, i.e. those facing the toughest lockdown measures, are experiencing markedly increased daily mortality figures. It is also known that in the Lombardy region, 90% of test-positive deaths occur not in intensive care units, but instead mostly at home. And more than 99% have serious pre-existing health conditions.
Professor Sucharit Bhakdi has called lockdown measures „useless“, „self-destructive“ and a „collective suicide“. Thus the extremely troubling question arises as to what extent the increased mortality of these elderly, isolated, highly stressed people with multiple pre-existing health conditions may in fact be caused by the weeks-long lockdown measures still in force.
If so, it may be one of those cases where the treatment is worse than the disease. (See update below: only 12% of death certificates show the coronavirus as a cause.)
Angelo Borrelli, head of the Italian Civil Protection Service, emphasizing the difference between deaths with and from coronaviruses.
March 22, 2020 (II)
In Switzerland, there are currently 56 test-positive deaths, all of whom were „high risk patients“ due to their advanced age and/or pre-existing health conditions. Their actual cause of death, i.e. from or simply with the virus, has not been communicated.
The Swiss government claimed that the situation in southern Switzerland (next to Italy) is „dramatic“, yet local doctors denied this and said everything is normal.
According to press reports, oxygen bottles may become scarce. The reason, however, is not a currently higher usage, but rather hoarding due to fear of future shortages.
In many countries, there is already an increasing shortage of doctors and nurses. This is primarily because healthcare workers testing positive have to self-quarantine, even though in many cases they will remain fully or largely symptom-free.
March 22, 2020 (III)
A model from Imperial College London predicted between 250,000 and 500,000 deaths in the UK „from“ Covid-19, but the authors of the study have now conceded that many of these deaths would not be in addition to, but rather part of the normal annual mortality rate, which in the UK is about 600,000 people per year. In other words, excess mortality would remain low.
Dr. David Katz, founding director of the Yale University Prevention Research Center, asks in the New York Times: „Is Our Fight Against Coronavirus Worse Than the Disease? There may be more targeted ways to beat the pandemic.“
According to Italian Professor Walter Ricciardi, „only 12% of death certificates have shown a direct causality from coronavirus“, whereas in public reports „all the people who die in hospitals with the coronavirus are deemed to be dying of the coronavirus“. This means that Italian death figures reported by the media have to be reduced by at least a factor of 8 to obtain actual deaths caused by the virus. Thus one ends up with at most a few dozen deaths per day, compared to an overall daily mortality of 1800 deaths and up to 20,000 flu deaths per year.
March 21, 2020 (I)
Spain reports only three test-positive deaths under the age of 65 (out of a total of about 1000). Their pre-existing health conditions and actual cause of death are not yet known.
On March 20, Italy reported 627 nationwide test-positive deaths in one day. By comparison, normal overall mortality in Italy is about 1800 deaths per day. Since February 21, Italy has reported about 4000 test-positive deaths. Normal overall mortality during this time frame is up to 50,000 deaths. It is not yet known to what extent normal overall mortality has increased, or to what extent it has simply turned test-positive. Moreover, Italy and Europe have had a very mild flu season in 2019/2020 that has spared many otherwise vulnerable people.
According to Italian news reports, 90% of test-positive deceased in the Lombardy region have died outside of intensive care units, mostly at home or in general care sections. Their cause of death and the possible role of quarantine measures in their deaths remain unclear. Only 260 out of 2168 test-positive persons have died in ICUs.
Bloomberg highlights that „99% of Those Who Died From Virus Had Other Illness, Italy Says“
Italy test-positive deaths by prior illnesses (ISS / Bloomberg)
March 21, 2020 (II)
The Japan Times asks: Japan was expecting a coronavirus explosion. Where is it? Despite being one of the first countries getting positive test results and having imposed no lockdown, Japan is one of the least-affected nations. Quote: „Even if Japan may not be counting all those infected, hospitals aren’t being stretched thin and there has been no spike in pneumonia cases.“
Italian researchers argue that the extreme smog in Northern Italy, the worst in Europe, may be playing a causative role in the current pneumonia outbreak there, as in Wuhan before.
In a new interview, Professor Sucharit Bhakdi, a world renowned expert in medical microbiology, says blaming the new coronavirus alone for deaths is „wrong“ and „dangerously misleading“, as there are other more important factors at play, notably pre-existing health conditions and poor air quality in Chinese and Northern Italian cities. Professor Bhakdi describes the currently discussed or imposed measures as „grotesque“, „useless“, „self-destructive“ and a „collective suicide“ that will shorten the lifespan of the elderly and should not be accepted by society.
March 20, 2020
According to the latest European monitoring report, overall mortality in all countries (including Italy) and in all age groups remains within or even below the normal range so far.
According to the latest German statistics, the median age of test-positive deaths is about 83 years, most with pre-existing health conditions that might be a possible cause of death.
A 2006 Canadian study referred to by Stanford Professor John Ioannidis found that common cold coronaviruses may also cause death rates of up to 6% in risk groups such as residents of a care facility, and that virus test kits initially falsely indicated an infection with SARS coronaviruses.
March 19, 2020 (I)
The Italian National Health Institute ISS has published a new report on test-positive deaths:
The median age is 80.5 years (79.5 for men, 83.7 for women).
10% of the deceased was over 90 years old; 90% of the deceased was over 70 years old.
At most 0.8% of the deceased had no pre-existing chronic illnesses.
Approximately 75% of the deceased had two or more pre-existing conditions, 50% had three more pre-existing conditions, in particular heart disease, diabetes and cancer.
Five of the deceased were between 31 and 39 years old, all of them with serious pre-existing health conditions (e.g. cancer or heart disease).
The National Health Institute hasn’t yet determined what the patients examined ultimately died of and refers to them in general terms as Covid19-positive deaths.
March 19, 2020 (II)
A report in the Italian newspaper Corriere della Sera points out that Italian intensive care units already collapsed under the marked flu wave in 2017/2018. They had to postpone operations, call nurses back from holiday and ran out of blood donations.
German virologist Hendrik Streeck argues that Covid19 is unlikely to increase total mortality in Germany, which normally is around 2500 people per day. Streeck mentions the case of a 78-year-old man with preconditions who died of heart failure, subsequently tested positive for Covid19 and thus was included in the statistics of Covid19 deaths.
According to Stanford Professor John Ioannidis, the new coronavirus may be no more dangerous than some of the common coronaviruses, even in older people. Ioannidis argues that there is no reliable medical data backing the measures currently decided upon.
March 18, 2020
A new epidemiological study (preprint) concludes that the fatality of Covid19 even in the Chinese city of Wuhan was only 0.04% to 0.12% and thus rather lower than that of seasonal flu, which has a mortality rate of about 0.1%. As a reason for the overestimated fatality of Covid19, the researchers suspect that initially only a small number of cases were recorded in Wuhan, as the disease was probably asymptomatic or mild in many people.
Chinese researchers argue that extreme winter smog in the city of Wuhan may have played a causal role in the outbreak of pneumonia. In the summer of 2019, public protests were already taking place in Wuhan because of the poor air quality.
New satellite images show how Northern Italy has the highest levels of air pollution in Europe, and how this air pollution has been greatly reduced by the quarantine.
A manufacturer of the Covid19 test kit states that it should only be used for research purposes and not for diagnostic applications, as it has not yet been clinically validated.
Datasheet of Covid19 virus test kit
March 17, 2020 (I)
The mortality profile remains puzzling from a virological point of view because, in contrast to influenza viruses, children are spared and men are affected about twice as often as women. On the other hand, this profile corresponds to natural mortality, which is close to zero for children and almost twice as high for 75-year-old men as for women of the same age.
The younger test-positive deceased almost always had severe pre-existing conditions. For example, a 21-year-old Spanish soccer coach had died test-positive, making international headlines. However, the doctors diagnosed an unrecognized leukemia, whose typical complications include severe pneumonia.
The decisive factor in assessing the danger of the disease is therefore not the number of test-positive persons and deceased, which is often mentioned in the media, but the number of people actually and unexpectedly developing or dying from pneumonia (so-called excess mortality). So far, this value remains very low in most countries.
In Switzerland, some emergency units are already overloaded simply because of the large number of people who want to be tested. This points to an additional psychological and logistical component of the current situation.
March 17, 2020 (II)
Italian immunology professor Sergio Romagnani from the University of Florence comes to the conclusion in a study on 3000 people that 50 to 75% of the test-positive people of all ages remain completely symptom-free – significantly more than previously assumed.
The occupancy rate of the North Italian ICUs in the winter months is typically already 85 to 90%. Some or many of these existing patients could also be test-positive by now. However, the number of additional unexpected pneumonia cases is not yet known.
A hospital doctor in the Spanish city of Malaga writes on Twitter that people are currently more likely to die from panic and systemic collapse than from the virus. The hospital is being overrun by people with colds, flu and possibly Covid19 and doctors have lost control.
March 14, 2020
According to the latest data of the Italian National Health Institute ISS, the average age of the positively-tested deceased in Italy is currently about 81 years. 10% of the deceased are over 90 years old. 90% of the deceased are over 70 years old.
80% of the deceased had suffered from two or more chronic diseases. 50% of the deceased had suffered from three or more chronic diseases. The chronic diseases include in particular cardiovascular problems, diabetes, respiratory problems and cancer.
Less than 1% of the deceased were healthy persons, i.e. persons without pre-existing chronic diseases. Only about 30% of the deceased are women.
The Italian Institute of Health moreover distinguishes between those who died from the coronavirus and those who died with the coronavirus. In many cases it is not yet clear whether the persons died from the virus or from their pre-existing chronic diseases or from a combination of both.
The two Italians deceased under 40 years of age (both 39 years old) were a cancer patient and a diabetes patient with additional complications. In these cases, too, the exact cause of death was not yet clear (i.e. if from the virus or from their pre-existing diseases).
The partial overloading of the hospitals is due to the general rush of patients and the increased number of patients requiring special or intensive care. In particular, the aim is to stabilize respiratory function and, in severe cases, to provide anti-viral therapies.
(Update: The Italian National Institute of Health published a statistical report on test-positive patients and deceased, confirming the above data.)
The following aspects should also be taken into account:
Northern Italy has one of the oldest populations and the worst air quality in Europe, which had already led to an increased number of respiratory diseases and deaths in the past and is likely an additional risk factor in the current epidemic.
South Korea, for instance, has experienced a much milder course than Italy and has already passed the peak of the epidemic. In South Korea, only about 70 deaths with a positive test result have been reported so far. As in Italy, those affected were mostly high-risk patients.
The few dozen test-positive Swiss deaths so far were also high-risk patients with chronic diseases, an average age of more than 80 years and a maximum age of 97 years, whose exact cause of death, i.e. from the virus or from their pre-existing diseases, is not yet known.
Furthermore, studies have shown that the internationally used virus test kits may give a false positive result in some cases. In these cases, the persons may not have contracted the new coronavirus, but presumably one of the many existing human coronaviruses that are part of the annual (and currently ongoing) common cold and flu epidemics. (1)
Thus the most important indicator for judging the danger of the disease is not the frequently reported number of positively-tested persons and deaths, but the number of persons actually and unexpectedly developing or dying from pneumonia (so-called excess mortality).
According to all current data, for the healthy general population of school and working age, a mild to moderate course of the Covid-19 disease can be expected. Senior citizens and persons with existing chronic diseases should be protected. The medical capacities should be optimally prepared.
Medical literature
(1) Patrick et al., An Outbreak of Human Coronavirus OC43 Infection and Serological Cross-reactivity with SARS Coronavirus, CJIDMM, 2006.
(2) Grasselli et al., Critical Care Utilization for the COVID-19 Outbreak in Lombardy, JAMA, March 2020.
(3) WHO, Report of the WHO-China Joint Mission on Coronavirus Disease 2019, February 2020.
Reference values
Important reference values include the number of annual flu deaths, which is up to 8,000 in Italy and up to 60,000 in the US; normal overall mortality, which in Italy is up to 2,000 deaths per day; and the average number of pneumonia cases per year, which in Italy is over 120,000.
Current all-cause mortality in Europe and in Italy is still normal or even below-average. Any excess mortality due to Covid-19 should become visible in the European monitoring charts.
xxxxxxxxxxxxxxxxxxxxx
china/leftist academia
Breitbart
Senate Report: Careless Elites Help China Steal Americans’ Technology
450
Top government leaders told NPR that federal agencies are years behind where they could have been if Chinese cybertheft had been openly addressed earlier. Bill Hinton Photography/Getty ImagesBill Hinton Photography/Getty Images
NEIL MUNRO22 Nov 2019301
14:14
Careless elites in government and in universities help the Chinese government steal U.S. technology and get taxpayer funding for Chinese research, according to a bipartisan report by the Senate investigations committee.
“This report follows an eight-month investigation into how the American taxpayer has, in effect, unwittingly funded research that has contributed to China’s global rise over the past 20 years,” GOP Sen. Rob Portman said November 19. he continued:
Our investigation focused on China’s most prominent program called the Thousand Talents Plan. Launched in 2008, China designed the Thousand Talents Plan to recruit 2,000 high-quality overseas experts. By 2017, China dramatically exceeds its recruitment goal, recruiting more than 7,000 ‘high-end professionals.’ Our report also details how the Chinese Communist Party controls and administers these talent recruitment programs.
The FBI failed to see the problem for a decade, and universities are still downplaying the problem, Portman said, adding:
U.S. universities and U.S.-based researchers must take responsibility in addressing this threat. If universities can vet employees for scientific rigor or allegations of plagiarism they also can vet for financial conflicts of interests and foreign sources of funding.
The co-chair of the report, Sen. Tom Carper, described the problem in his short statement on November 19:
Due to our lax oversight of federal research grants and the ineffective and mixed messages agencies have been delivering to schools and researchers on this topic over the years, we’ve given the Chinese and likely other countries a running start. We can’t continue to allow this to happen!
But Carper also let the Democrat-allied research sector off the hook, saying:
I hope that the publication of this information will inspire a serious and urgent conversation on university campuses and among scientists and researchers about the growing threat that China’s talent recruitment efforts pose for our country. I hope it also leads to an appreciation of the consequences that come from giving a foreign government so much access to and control over the vital research we rely on to fuel our economic competitiveness and bolster our national defense.
Having said that, we should not be stepping back from international collaboration in science and technology. As China’s aggressive efforts show, our scientists, research institutions, and universities remain the best in the world and serve as a magnet for talented people looking to do meaningful, cutting edge work.
Portman’s report also did a favor for U.S. companies and universities by downplaying the visa programs that allow companies, universitie, and even the government to hire foreign graduates for critical research and development.
For example, universities employ roughly 100,000 visa workers via the H-1B, J-1, Optional Practical Training and other programs. This massive recruiting sidelines Americans and lower-risk Europeans at universities.
Overall, roughly 1.5 million foreign graduates hold U.S. jobs through visa programs, including many jobs giving them access to vital networks, healthcare data, and personal financial data. Legislators in the House and GOP Senators are trying to expand those visa programs via the H.R.1044 and S.386 bills.
Neil Munro
✔
@NeilMunroDC
GAO warns DHS to do more to prevent the smuggling of Indian and Chinese graduates into U.S. white-collar careers, such as software, healthcare, accounting, etc. Most smuggling takes place via the universities' 'OPT' work-permit giveaway to foreign grads. http://bit.ly/2ZlrlEc
Federal Investigation Warns DHS About Fraud in Work Visa Programs
Federal agencies need to do more to prevent the smuggling of Indian and Chinese college graduates into white-collar jobs, says a GAO report.
breitbart.com
75
9:53 AM - Aug 27, 2019
Twitter Ads info and privacy
77 people are talking about this
The November 18 report is titled, “Threats to the U.S. Research Enterprise: China’s Talent Recruitment Plans.”
The report, which was released November 19 as media attention was focused on the House’s effort to impeach the President:
Launched in 2008, [China’s] Thousand Talents Plan incentivizes individuals engaged in research and development in the United States to transmit the knowledge and research they gain here to China in exchange for [Chinese provided] salaries, research funding, lab space, and other incentives.
The report whines that the Chinese government is being “unfair” because it is stealing technology to achieve its goal of political, military, and cultural dominance over the United States:
China unfairly uses the American research and expertise it obtains for its own economic and military gain. In recent years, federal agencies have discovered talent recruitment plan members who downloaded sensitive electronic research files before leaving to return to China, submitted false information when applying for grant funds, and willfully failed to disclose receiving money from the Chinese government on U.S. grant applications.
This report exposes how American taxpayer funded research has contributed to China’s global rise over the last 20 years. During that time, China openly recruited U.S.-based researchers, scientists, and experts in the public and private sector to provide China with knowledge and intellectual capital in exchange for monetary gain and other benefits. At the same time, the federal government’s grant-making agencies did little to prevent this from happening, nor did the FBI and other federal agencies develop a coordinated response to mitigate the threat.
But science-industry advocates pushed back against the report, arguing that the problem is just a few bad apples in the barrel, not a large-scale, organized, intelligent, government seeking global advantage over the United States.
“Foreign-born scientists contribute to improving health, fostering innovation, and advancing science,” said a statement from Michael Lauer, the deputy director of external research at the taxpayer-funded National Institutes of Health, which conducts medical research. He said:
Unfortunately, we are aware that a few foreign governments have initiated systematic programs to capitalize on the collaborative nature of biomedical research and unduly influence U.S.-based researchers … we acknowledge these concerns [but] the vast majority of Chinese scientists working in America are committed to the cause of expanding knowledge for the betterment of humankind, and to do so in a fair and honest way.
…
The individuals violating laws and policies represent a small proportion of scientists working in and with U.S. institutions
“Dating back to the Manhattan Project era, the United States has attracted the best and brightest scientists from around the world,” said a statement from Rebecca Keiser at the international office of the National Science Foundation, which funds engineering and hardware research throughout the United States. She downplayed China’s threat, saying:
NSF is committed to implementing all reasonable and necessary [BBN emphasis] steps to ensure the integrity of federally-funded research while protecting the ecosystem of innovation and discovery that has propelled the United States to global leadership in science and engineering.
Portman slammed the NSF’s no-problem-here response:
In July 2019, just a few months ago, the NSF prohibited its employees from joining [China’s] talent recruitment programs; but the policy does not apply to the more than 40,000 NSF-funded researchers who actually conduct the research and are the most likely to be members and targets of a talent recruitment program. And NSF doesn’t any employees dedicated to grant oversight.
Neil Munro
✔
@NeilMunroDC
FBI busts company which allegedly helped get 'Optional Practical Training' work permits via fraud for roughly 1,900 Chinese grads, to steal jobs & salaries from American grads. More to come, despite media silence on white-collar job theft #HR1044 http://bit.ly/2Zdr42t
FBI: Company Faked White-Collar Jobs for 1,900 Chinese Migrants
The government awarded hundreds of work permits to a company that apparently trafficked almost 2,000 Chinese grads into white-collar jobs.
breitbart.com
123
12:16 PM - Apr 15, 2019
Twitter Ads info and privacy
113 people are talking about this
The Department of State also sought to downplay the need for vigilance against the Chinese government’s program. “The strength of our global leadership in science and research rests on our openness,” said Edward Ramotowski, a deputy assistant secretary of state. He continued:
For decades, foreign scientists, including from China, have contributed substantially to scientific progress and innovations at research institutions across the United States.
…
We continue to welcome Chinese students who come here lawfully to study in the United States. We also recognize the inherent value of interpersonal exchange between our two countries.
Ramotowski admitted there is a problem — but said the department could do little to stop the Chinese campaign:
Unfortunately, the Chinese government is actively encouraging, and in many cases coercing, its citizens to abuse the goodwill and openness of our country for its own benefit.
…
Under the [nation’s immigration law], consular officers cannot currently deny a visa application on national security grounds if they have reason to believe that the visa applicant seeks to enter the United States to lawfully gain knowledge through work or study in a sensitive area of technology that is not export controlled – for example, certain technology related to robotics or artificial intelligence.
,…
the law as it is currently written restricts the discretion of consular officers to find visa applicants ineligible, even when there is reason to believe the applicant may intend to export technology many consider to be sensitive but which is not currently controlled.
Neil Munro
✔
@NeilMunroDC
DHS investigators discover Chinese fraud ring intended to get Chinese into US colleges and white-collar jobs. Tip of the iceberg. Tho job theft is usually good for biz & investors (& bad for employees) it also threatens investors via IP theft & legal risk http://bit.ly/2Cmeynz
Feds Arrest California Group for Aiding Chinese Exam and Visa Cheats
Federal officials arrested five people for helping Chinese nationals cheat their way into U.S. universities, so allowing them into U.S. jobs.
breitbart.com
57
3:00 PM - Mar 15, 2019
Twitter Ads info and privacy
53 people are talking about this
An FBI official insisted that they would downplay China’s effort to recruit Chinese-Americans and legal-immigrant Chinese. “I cannot overstate that ethnicity plays no role in our investigations,” said John Brown, the assistant director of the FBI anti-spy division. He continued:
We have never asked any university, company, or other entity to profile people based on ethnicity, and we would be appalled if they did. As is true for all FBI programs, we investigate specific individuals when we have specific evidence that they are engaged in unlawful activity or pose a threat to national security. Nor do we have any intention of chilling academic freedom or curtailing international exchange—quite the reverse. International collaboration plays a crucial role in the development of scientific breakthroughs throughout U.S. research institutions.
Brown’s insistence on color-blind political correctness contrasts with sharp testimony given to the committee by his own boss, FBI Director Christopher Wray:
[T]he use of nontraditional collectors, especially in the academic setting, whether it’s professors, scientists, students, we see in almost every field office that the FBI has around the country. It’s not just in major cities. It’s in small ones as well. It’s across basically every discipline. I think the level of naiveté on the part of the academic sector about this creates its own issues. They’re exploiting the very open research and development environment that we have, which we all revere, but they’re taking advantage of it.
The U.S. media have cataloged a variety of cases. In July 2018, for example, Business Insider reported:
Liu Ruopeng, known as China’s Elon Musk, is just 35 years old and is believed to be worth $2.7 billion, according to the “Today” show.
But before he created his money-making “Future Studio” in China, Liu studied at Duke University from 2006 to 2009 under David Smith, one of the world’s experts on metamaterials, or “some weird material that doesn’t exist in nature,” as the professor describes it.
Some observers, including a former assistant director of counterintelligence at the FBI, believe that Liu was sent to Smith’s lab by the Chinese government to steal intellectual property.
…
The case, however, was closed years later due to shortage of evidence.
The headlines in the Senate’s report sketch out the huge scale of the failure by government and elites to guard Americans’ technological base:
China’s Systematic Targeting of Critical Technologies … The NSF is Unprepared to Stop Foreign Talent Recruitment Plan Members From Misappropriating U.S.-Funded Research … Weaknesses in NIH’s Internal Controls for Monitoring and Permitting Foreign Access to Sensitive Data … Energy Did Not Implement Policies Prohibiting Involvement in Foreign Talent Recruitment Plans Until 2019 … Consular Affairs Has Limited Authority to Deny Visa Applicants on National Security Grounds Related to Intellectual Property Theft … Commerce Rarely Denies License Applications … The FBI Took Nearly Two Years to Disseminate Talent Recruitment Plan Information to Federal Grant-Making Agencies … The FBI Disbanded its National Security Higher Education Advisory Board
The report described a few of China’s brazen campaigns to steal technology:
According to the complaint, Liu operated the New York office of the China Association for International Exchange of Personnel (“CAIEP-NY”). CAIEP-NY is a Chinese government agency that, among other things, recruits scientists, academics, engineers and other experts in the United States to work in China. Liu worked with other Chinese government employees in the United States, including at Chinese consulates, to fraudulently procure J-1 Research Scholar visas for a CAIEP-NY employee and a prospective CAIEP-NY employee. In addition, Liu attempted to assist a CAIEP-NY hire to obtain a J-1 [visa] research scholar visa under false pretenses. Liu contacted multiple U.S. universities to try to arrange for a university to invite the CAIEP-NY hire to come as a J-1 Research Scholar. Liu was in communication with an individual affiliated with a U.S. university who explained that it would “be very easy for us to give him/her a J-1 [visa].”
Federal agencies do not even deny visas to researchers employed by China’s military universities, the report said:
[The Department of] Commerce issued licenses to individuals associated with one of the seven Chinese universities, known as the “Seven Sons” that are under “direct supervision” by China’s Military Commission. Two of these universities, Beihang University and Northwest Polytechnical University, are currently on Commerce’s Entity List. The other five institutions, Beijing Institute of Technology, Harbin Institute of Technology, Harbin Institute Engineering University, Nanjing University of Aeronautics and Astronautics, and Nanjing University of Science and Technology, are not on Commerce’s Entity List as of this report. Commerce granted more than 150 licenses to Chinese nationals linked to one of the seven defense universities. A sample of these license applications follow below.
In 2018, a U.S. company applied for a Chinese national to access semiconductor technology and converter integrated circuits. That same individual received a Bachelor’s of Electronic Information Engineering from Beihang University.
In 2017, a U.S. company applied for a Chinese national to work as a packaging engineer, providing packaging design, development, and support for semiconductor technology. That same individual received a Bachelor’s in Optical Information Science and Technology and a Masters in Optics from the Northwestern Polytechnical University.
The federal government also allows employees of Huawei — the government-run networking company — to get jobs at U.S. research centers.
According to information reviewed by the Subcommittee, Commerce issued at least 65 licenses to Chinese nationals who previously worked for or were supported by Huawei. Huawei is on Commerce’s Entity List as of this report. A sample of these license applications follow below.
In 2018, a U.S. company applied for a Chinese national to work on systems for telecommunications carriers, cable providers, and data center customers. This individual previously worked at Huawei as a software engineer.
In 2017, a U.S. company applied for a Chinse national that previously worked on machine learning and embedded software for Huawei and also graduated from Harbin Institute of Technology with a bachelor’s degree in engineering.
Breitbart News has extensively covered the H-1 and OPT visa worker programs which allow Chinese researchers and workers to take jobs from Americans throughout the U.S. economy.
The Chinese government has been raiding American university databases for technology which can help it develop undersea warfare technology, according to the Wall Street Journal.
But the hacking may be overkill, because federal regulations already allow Chinese graduates and scientists to take jobs in taxpayer-funded undersea-warfare research centers and universities. The approval is provided by the controversial “Optional Practical Training” program which allows universities to effectively sell work permits to foreign students, and to deny jobs to their own U.S. graduates.
The Wall Street Journal reported:
The University of Hawaii, the University of Washington and Massachusetts Institute of Technology are among at least 27 universities in the U.S., Canada and Southeast Asia that Beijing has targeted, according to iDefense, a cybersecurity intelligence unit of Accenture Security.
…iDefense said it identified targeted universities by observing that their networks were pinging servers located in China and controlled by a Chinese hacking group known to researchers interchangeably as Temp.Periscope, Leviathan or Mudcarp. Researchers at the U.S. cyber firm FireEye, who have studied the same group, said the iDefense findings were generally consistent with their own intelligence.
…The majority of the universities targeted either house research hubs focused on undersea technology or have faculty on staff with extensive experience in a relevant field, and nearly all have links to a Massachusetts oceanographic institute that also was likely compromised in the cyber campaign, iDefense said.
But the OPT program allows Chinese navy officers and other foreigners to get underseas warfare jobs.
The OPT work permits are managed by the Department of Homeland Security.
The program was not established by Congress, but it was created by agency officials to provide U.S. technology companies with a cheap supply of college graduate workers. Employers of OPT workers do not have to pay Social Security or Medicare taxes, so it is cheaper for companies and universities to hire foreigners instead of young American graduates.
The program allows foreign graduates with technology credentials to work in U.S. jobs for three years after graduating from a U.S. university. Graduates with non-technology credentials are allowed to work for one year. A paired program, dubbed the Curricular Practical Training program, provides a one-year work permit to foreigners before graduation.
Roughly 400,000 foreign students had OPT work permits in 2017, so pushing hundreds of thousands of Americans out of promising jobs.
Many foreign graduates use the OPT work permits as a springboard into the H-1B program, which provides work permits lasting at least three years. In turn, many of the former OPT students who get into the H-1B program can also win green cards and so compete for jobs against Americans for the next 5o or 70 years — much to the advantage of employers, investors, and real estate owners. The OPT program was created by Michael Chertoff, who was then serving as the head of the Department of Homeland Security under President George W. Bush.
Technology graduates can use their OPT work permits to take jobs in a very wide range of careers.
The DHS’s 2016 list of STEM work includes option “29.0307” which is described “Undersea Warfare.” It can be found sandwiched between “Operational Geography” and “Military Applies Science.”
The DHS list includes a very wide range of jobs, from “Directed Energy Systems” to “Low-Observables and Stealth Technology” to “Veterinary Physiology” to “Urban Forestry.”
The list also allows foreign graduates to work as technicians: “Architectural Engineering Technology/Technician,” “Biomedical Technology/Technician,” “Heating, Ventilation, Air Conditioning and Refrigeration Engineering Technology/Technician,” and “Solar Energy Technology/Technician.”
Some companies and universities exclude foreign graduates from jobs. For example, the Wall Street Journal article says the hacker targeted Penn State’s Applied Research Laboratory. The laboratory requires employees have U.S. citizenship. The university, however, helps foreign students to enroll in the OPT program.
Currently, Senators and House members have drafted two bills — HR1044 and S.386 — that will help many former OPT workers get quick citizenship. The bills would put roughly 70,000 Chinese and 300,000 Indian college graduates on a fast track to green cards and citizenship — and sideline hundreds of thousands of American graduates.
Neil Munro
✔
@NeilMunroDC
US college grads lose jobs, careers & salaries b/c companies' have imported 1.5 million+ low-wage, indentured, non-immigrant, perma-temporary visa-workers. Media ignores their peers' losses but displays noble concern for migrants. Wall St. laughs #HR1044 http://bit.ly/2EErxCO
GOP Senators Push Green Card Reward for Indian Visa Workers
GOP Senators are trying to reward 300,000 Indian visa workers for taking college jobs from at least 200,000 American graduates.
breitbart.com
123
2:25 PM - Mar 2, 2019
Twitter Ads info and privacy
234 people are talking about this
The Senate co-sponsors of the green card giveaway bill include Republicans and Democrats:
Sen. Roy Blunt (R-MO)
Sen. Susan Collins (R-ME)
Sen. Jim Moran (R-KS)
Sen. Tom Carper (D-DE)
Sen. Ron Wyden (D-OR)
Sen. Maria Cantwell (D-WA)
Sen. Cory Gardner (R-CO)
Sen. Tom Cotton (R-AR)
Sen. Tammy Baldwin (D-WI)
Sen. Jeff Merkley (D-OR)
Sen. Michael Bennet (D-CO)
Sen. Kevin Cramer (R-ND)
Sen. Krysten Sinema (D-AZ)
The news about Chinese hacking also comes amid a renewed effort by the White House to protect U.S. science and technology from theft by Chinese researchers.
White House officials are using trade talks to change Chinese “behaviors so they don’t steal our technology by infiltrating people into companies and into even national laboratory,” Commerce Secretary Wilbur Ross said May 1. A leading goal is “changing the practice so they don’t force technology transfer,” when U.S. companies invest in China, he said in a talk at the annual CPAC meeting.
xxxxxxxxxxxxxxx
COVID originated in US
New evidence suggests coronavirus may have originated in the US
United World International
More and more dignitaries and journalists around the world are beginning to argue that the source of the new type of coronavirus could have been US Department of Defense biological laboratories.
The new coronavirus could have been brought to the Chinese city of Wuhan by the US military. Zhao Lijian, the deputy head of the Chinese Foreign Ministry’s information department, suggested this possibility on Twitter last week.
In his tweet, the official attached a video clip of Robert Redfield, head of the Center for Disease Prevention and Control (CDC), in the US House of Representatives, where he points out that coronavirus was found in several dead Americans who were diagnosed with influenza during post-mortem examination.
Lijian Zhao 赵立坚
✔
@zlj517
2/2 CDC was caught on the spot. When did patient zero begin in US? How many people are infected? What are the names of the hospitals? It might be US army who brought the epidemic to Wuhan. Be transparent! Make public your data! US owe us an explanation!
Embedded video
15.5K
9:37 AM - Mar 12, 2020
Twitter Ads info and privacy
16.5K people are talking about this
“It might be the US army who brought the epidemic to Wuhan,” he stated. “Be transparent! Make public your data! The US owes us an explanation!”
Iran’s Supreme Leader Ali Khamenei announced that the coronavirus epidemic in Iran was the result of “a biological attack.”
According to Bulgarian Journalist Dilyana Gaytandzhieva “the US Army has a history of transporting viruses as diplomatic cargo for secret military programs. Diplomatic bags have diplomatic immunity from search or seizure”
Dilyana Gaytandzhieva
@dgaytandzhieva
The US Army has a history of transporting viruses as diplomatic cargo for secret military programs. Diplomatic bags have diplomatic immunity from search or seizure. Documents here ��Dilyana …
US diplomats involved in trafficking of human blood and pathogens for secret military program -...
Leaked documents reveal that the US Embassy to Tbilisi transports pathogens, as well as frozen human blood, as diplomatic cargo.
dilyana.bg
Lijian Zhao 赵立坚
✔
@zlj517
2/2 CDC was caught on the spot. When did patient zero begin in US? How many people are infected? What are the names of the hospitals? It might be US army who brought the epidemic to Wuhan. Be transparent! Make public your data! US owe us an explanation!
Embedded video
745
10:40 PM - Mar 12, 2020
Twitter Ads info and privacy
659 people are talking about this
The Journalist mentioned its own investigation of American biological laboratory near Tbilisi. The US Embassy to Tbilisi transports frozen human blood and pathogens as diplomatic cargo for a secret US military program.
Former adviser to Russian President Vladimir Putin Sergey Glazyev said that the coronavirus was man-made. According to him, this is a manifestation of the US hybrid war against sectors of the economy they do not control.
A former American counter-terrorism specialist and military intelligence officer of the CIA, Philip Giraldi, also declared that novel coronavirus was produced in a laboratory, possibly as a biological warfare agent. However, he said he did not know if it was an American, Israeli or Chinese laboratory which produced it.
All of these statements have been criticized by the Western media as conspiracy theories. However, there are many questions about that source of new coronavirus the US needs to answer.
For instance, the White House website published a petition to test the biochemical laboratory in Fort Detrick (Walter Reed Army Institute of Research, WRAIR) – the largest biomedical research institution run by the Ministry US defense.).
This is a laboratory in Maryland that processes high-level disease-causing materials such as Ebola, which was closed after the US Centers for Disease Control and Prevention (CDC) refused to work with the organization in July 2019.
The suspension was a result of a number of causes, including non-compliance with local procedures and the lack of periodic retraining of employees of biocontrol laboratories. The media reported that the laboratory’s sewage disinfection system also did not meet the standards set by the Federal Agent Selection Program.
The lab, which closed more than six months ago, recently attracted public attention as a result of a petition filed on the White House website on March 10 which listed some time differences between the closure and the outbreak of COVID-19.
For example, “a large-scale ‘influenza’ outbreak killed more than 10,000 people” in the US in August 2019 after the lab’s closing. Meanwhile, the COVID-19 epidemic erupted around the world in February 2020 after the US hosted event 201 – The Global Pandemic Exercise – in October 2019.
Last year Sen. Chris Van Hollen (D-Maryland) sent a letter to acting Army Secretary Ryan McCarthy asking him to give any information about “ any exposure or potential exposure of any person to any biological agent or toxin.” The US Senator mentioned that “according to press reports, “[t]he suspension was due to multiple causes, including failure to follow local procedures and a lack of periodic recertification training for workers in the biocontainment laboratories… The wastewater decontamination system also failed to meet standards set by the Federal Select Agent Program which oversees the possession, use, and transfer of biological agents with the potential to pose a severe threat to public health.”
A strange coincidence
There is now information that confirms at least the possibility of creating the current strain of coronavirus in artificial conditions.
In 2015, Professor Ralph Baric, the head of the Department of Epidemiology at the University of North Carolina at Chapel Hill, made a chimera of Chinese bat coronavirus and published an article stating that this virus is very dangerous. Swiss scientists, scientists from Harvard University and the head of the laboratory of special pathogens at the Wuhan Institute of Virology all took part in the work.
At the same time, Ralph Baric also developed an antiviral drug against coronavirus for Gilead Science. It is a rather interesting coincidence that the US Media later wrote that “US Army Medical Research and Development Command has signed an arrangement with Gilead Sciences to provide the company’s investigational coronavirus drug to U.S. troops confirmed to have the COVID-19 virus.”
According to Yu Wenbin, an associate researcher at the Chinese Academy of Sciences, several groups were identified, including the A, B, C, D of haplotypes of new coronavirus. “In Hubei, only coronavirus from Group C are detected, but in the US the viruses from all five groups have been found.”
The British Pirbright Institute recognized that, at the request of the Melinda and Bill Gates Foundation, they had done some research on coronaviruses that infect animals. However they rejected that they were working on human coronaviruses.
The Higher Institute of Health in Italy noted that most of the initial diseases in Italy cannot be linked to China. That is, the virus most likely appeared in Italy independently.
This adds more evidence to arguments and rumors that coronavirus may have originated in the US.
xxxxxxxxxxxx
Swiss Propaganda Research
SWPRS
Facts about Covid-19
|